Incidental Mutation 'R9228:Tlr9'
ID 700026
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Name toll-like receptor 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9228 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 106222598-106226883 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106225553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 681 (E681V)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
AlphaFold Q9EQU3
PDB Structure Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062241
AA Change: E681V

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: E681V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G A 3: 122,924,625 A56T probably benign Het
2310050C09Rik C T 3: 92,868,644 G244D probably benign Het
4930438A08Rik A T 11: 58,287,470 I119F Het
Abca12 A T 1: 71,293,440 I1254N probably damaging Het
Abcb11 G T 2: 69,308,465 Y157* probably null Het
Adcy7 G A 8: 88,318,047 probably null Het
Adnp A G 2: 168,184,878 Y166H probably damaging Het
Adprhl1 A G 8: 13,225,279 V493A probably benign Het
Ahctf1 T C 1: 179,784,120 T562A probably benign Het
Amotl1 T A 9: 14,593,024 N296I possibly damaging Het
Ankar A G 1: 72,674,051 V693A probably benign Het
Ankrd16 T C 2: 11,781,507 V189A probably benign Het
Bmp1 A G 14: 70,519,898 L47P probably benign Het
Cacna2d4 A G 6: 119,271,515 D429G probably benign Het
Cadps2 T A 6: 23,688,928 E127D probably benign Het
Cd109 A T 9: 78,669,760 I580F possibly damaging Het
Cdrt4 T A 11: 62,951,298 I2N unknown Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chuk A T 19: 44,107,350 W15R probably damaging Het
Cpvl C T 6: 53,974,794 M1I probably null Het
Cyfip1 A G 7: 55,900,010 M642V probably damaging Het
Dhh T A 15: 98,897,876 R133* probably null Het
Dnmt3b G A 2: 153,666,060 V212M probably benign Het
Dync2li1 A G 17: 84,649,709 S301G probably benign Het
Epas1 A C 17: 86,826,562 I500L possibly damaging Het
Ephb4 A T 5: 137,354,562 I136F possibly damaging Het
Foxg1 T C 12: 49,384,537 F18L unknown Het
Frem1 T C 4: 83,001,820 E432G probably damaging Het
Gm5591 T A 7: 38,528,061 M1L probably benign Het
Gpld1 A T 13: 24,952,917 S73C probably damaging Het
Hddc3 A G 7: 80,343,580 I52V probably benign Het
Hmgcll1 A T 9: 76,084,450 T252S probably damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Jph2 A G 2: 163,338,686 V675A probably benign Het
Kifap3 T C 1: 163,862,097 F550S probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
L1td1 T C 4: 98,737,695 V643A possibly damaging Het
L3mbtl3 C T 10: 26,336,257 M255I unknown Het
Layn T A 9: 51,057,537 D302V probably damaging Het
Lpcat4 A G 2: 112,242,073 I136V possibly damaging Het
Lrp1 T A 10: 127,546,938 D3658V probably damaging Het
Metap1d T C 2: 71,522,556 L243S possibly damaging Het
Midn T A 10: 80,154,441 H315Q probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myh2 T C 11: 67,186,696 S886P probably benign Het
Nemf T C 12: 69,341,319 I396V probably damaging Het
Nemp1 T G 10: 127,689,358 V127G possibly damaging Het
Nkx3-1 C T 14: 69,190,778 T25M possibly damaging Het
Nmral1 A C 16: 4,713,767 L208R probably damaging Het
Nol6 A T 4: 41,116,422 I989N probably benign Het
Olfr1126 T A 2: 87,457,563 C133S possibly damaging Het
Palld A T 8: 61,720,537 S363T probably damaging Het
Pcdha11 A G 18: 37,011,459 D201G probably damaging Het
Per2 A G 1: 91,438,359 C339R probably damaging Het
Phactr4 T C 4: 132,370,563 T455A possibly damaging Het
Phc2 T C 4: 128,723,269 I445T probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ppp2r5e T A 12: 75,593,289 K13* probably null Het
Ptafr T C 4: 132,579,302 M1T probably null Het
Rbms1 G A 2: 60,779,743 P208S probably benign Het
Scg3 T A 9: 75,651,673 I419F probably damaging Het
Scn1a T C 2: 66,299,755 T219A probably benign Het
Sec14l4 A G 11: 4,039,977 D92G probably damaging Het
Senp3 G T 11: 69,678,259 Q359K probably damaging Het
Sirt1 T C 10: 63,337,078 D142G probably damaging Het
Skint2 T C 4: 112,625,842 M148T possibly damaging Het
Skiv2l2 A T 13: 112,914,354 probably null Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Snai2 T A 16: 14,706,928 D99E probably damaging Het
Spg7 A G 8: 123,080,669 K395E possibly damaging Het
Sphk2 G A 7: 45,710,913 H556Y possibly damaging Het
Supt6 A C 11: 78,225,786 F637L probably benign Het
Tcam1 A G 11: 106,286,466 N428S probably damaging Het
Tctn3 C T 19: 40,608,248 R276K probably benign Het
Timm29 G A 9: 21,593,360 R108H probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tns3 T C 11: 8,450,094 K1169E probably damaging Het
Trim72 A C 7: 128,009,143 D271A possibly damaging Het
Trpv4 A T 5: 114,634,561 D369E probably benign Het
Ttn A G 2: 76,752,848 L22567P probably damaging Het
Uimc1 G A 13: 55,075,839 P207S probably damaging Het
Unc5d A T 8: 28,675,420 V781E probably damaging Het
Upk3bl C T 5: 136,057,222 P4L unknown Het
Vmn1r201 A G 13: 22,475,500 N295D probably benign Het
Vmn2r69 A G 7: 85,415,489 I63T probably benign Het
Zfyve28 T C 5: 34,217,444 T409A probably benign Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
R7385:Tlr9 UTSW 9 106225264 missense probably damaging 1.00
R7455:Tlr9 UTSW 9 106224530 missense probably benign 0.00
R7561:Tlr9 UTSW 9 106225949 missense probably benign 0.00
R8889:Tlr9 UTSW 9 106222635 start gained probably benign
R8892:Tlr9 UTSW 9 106222635 start gained probably benign
R8926:Tlr9 UTSW 9 106226014 missense probably benign
R9221:Tlr9 UTSW 9 106224773 missense probably damaging 1.00
R9581:Tlr9 UTSW 9 106224311 missense probably damaging 1.00
Z1176:Tlr9 UTSW 9 106223663 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCTTCCAAGGCCTGAGTGG -3'
(R):5'- ACGTCTAGAACTGTCAGGTTC -3'

Sequencing Primer
(F):5'- TGAGTGGCCTGCTGAAGC -3'
(R):5'- TCAGGTTCATCACAATGGGC -3'
Posted On 2022-02-07