Incidental Mutation 'R0759:C1s1'
ID70003
Institutional Source Beutler Lab
Gene Symbol C1s1
Ensembl Gene ENSMUSG00000038521
Gene Namecomplement component 1, s subcomponent 1
SynonymsC1s
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124530345-124542359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124531437 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 531 (N531S)
Ref Sequence ENSEMBL: ENSMUSP00000125712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160505] [ENSMUST00000162443]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159143
Predicted Effect probably damaging
Transcript: ENSMUST00000160505
AA Change: N531S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125531
Gene: ENSMUSG00000038521
AA Change: N531S

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160967
Predicted Effect probably damaging
Transcript: ENSMUST00000162443
AA Change: N531S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125712
Gene: ENSMUSG00000038521
AA Change: N531S

DomainStartEndE-ValueType
CUB 15 136 1.08e-29 SMART
EGF_CA 137 178 1.79e-7 SMART
CUB 181 296 5.89e-31 SMART
CCP 300 360 3.22e-5 SMART
CCP 365 427 5.48e-8 SMART
Tryp_SPc 443 681 1.88e-70 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in C1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:C1s1 APN 6 124541334 missense probably benign 0.02
IGL02590:C1s1 APN 6 124531276 missense possibly damaging 0.89
IGL02968:C1s1 APN 6 124540351 missense probably damaging 0.99
IGL03301:C1s1 APN 6 124541324 splice site probably benign
BB008:C1s1 UTSW 6 124533400 missense probably damaging 1.00
BB018:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R0105:C1s1 UTSW 6 124541318 splice site probably benign
R0396:C1s1 UTSW 6 124533354 missense probably benign 0.03
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1145:C1s1 UTSW 6 124540800 missense probably damaging 1.00
R1396:C1s1 UTSW 6 124531051 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1466:C1s1 UTSW 6 124531131 missense probably damaging 1.00
R1627:C1s1 UTSW 6 124537480 missense probably damaging 1.00
R1855:C1s1 UTSW 6 124534356 critical splice donor site probably null
R2010:C1s1 UTSW 6 124537394 missense probably damaging 1.00
R2349:C1s1 UTSW 6 124541473 start gained probably benign
R4544:C1s1 UTSW 6 124531540 missense probably benign 0.31
R4661:C1s1 UTSW 6 124536490 missense probably benign 0.22
R5383:C1s1 UTSW 6 124534401 missense probably damaging 1.00
R5687:C1s1 UTSW 6 124540950 missense probably benign 0.01
R5846:C1s1 UTSW 6 124540953 missense possibly damaging 0.93
R6289:C1s1 UTSW 6 124531176 missense probably damaging 0.99
R6410:C1s1 UTSW 6 124531158 missense probably damaging 1.00
R6983:C1s1 UTSW 6 124540896 missense possibly damaging 0.93
R7931:C1s1 UTSW 6 124533400 missense probably damaging 1.00
R8141:C1s1 UTSW 6 124531362 missense probably damaging 1.00
R8341:C1s1 UTSW 6 124531156 missense probably damaging 1.00
R8399:C1s1 UTSW 6 124535293 missense probably benign 0.00
RF029:C1s1 UTSW 6 124541351 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCGCCAGCACAGATCATGTTGTC -3'
(R):5'- GGCTGCTCACGTTTTGGAGAAAATC -3'

Sequencing Primer
(F):5'- TGTCAGTGAAAACATAGTCCTCAGG -3'
(R):5'- GGAGAAAATCTCCGACCCTTTAATG -3'
Posted On2013-09-30