Incidental Mutation 'R9228:Bmp1'
ID 700049
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9228 (G1)
Quality Score 111.008
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70757338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 47 (L47P)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022692] [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022692
SMART Domains Protein: ENSMUSP00000022692
Gene: ENSMUSG00000022097

DomainStartEndE-ValueType
SF_P 1 193 7.3e-150 SMART
BRICHOS 94 193 3.29e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022693
AA Change: L47P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: L47P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
AA Change: L47P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226906
AA Change: L47P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G A 3: 122,718,274 (GRCm39) A56T probably benign Het
4930438A08Rik A T 11: 58,178,296 (GRCm39) I119F Het
Abca12 A T 1: 71,332,599 (GRCm39) I1254N probably damaging Het
Abcb11 G T 2: 69,138,809 (GRCm39) Y157* probably null Het
Adcy7 G A 8: 89,044,675 (GRCm39) probably null Het
Adnp A G 2: 168,026,798 (GRCm39) Y166H probably damaging Het
Adprhl1 A G 8: 13,275,279 (GRCm39) V493A probably benign Het
Ahctf1 T C 1: 179,611,685 (GRCm39) T562A probably benign Het
Amotl1 T A 9: 14,504,320 (GRCm39) N296I possibly damaging Het
Ankar A G 1: 72,713,210 (GRCm39) V693A probably benign Het
Ankrd16 T C 2: 11,786,318 (GRCm39) V189A probably benign Het
Cacna2d4 A G 6: 119,248,476 (GRCm39) D429G probably benign Het
Cadps2 T A 6: 23,688,927 (GRCm39) E127D probably benign Het
Cd109 A T 9: 78,577,042 (GRCm39) I580F possibly damaging Het
Cdrt4 T A 11: 62,842,124 (GRCm39) I2N unknown Het
Cep250 C T 2: 155,812,042 (GRCm39) A446V unknown Het
Chuk A T 19: 44,095,789 (GRCm39) W15R probably damaging Het
Cpvl C T 6: 53,951,779 (GRCm39) M1I probably null Het
Cyfip1 A G 7: 55,549,758 (GRCm39) M642V probably damaging Het
Dhh T A 15: 98,795,757 (GRCm39) R133* probably null Het
Dnmt3b G A 2: 153,507,980 (GRCm39) V212M probably benign Het
Dync2li1 A G 17: 84,957,137 (GRCm39) S301G probably benign Het
Epas1 A C 17: 87,133,990 (GRCm39) I500L possibly damaging Het
Ephb4 A T 5: 137,352,824 (GRCm39) I136F possibly damaging Het
Foxg1 T C 12: 49,431,320 (GRCm39) F18L unknown Het
Frem1 T C 4: 82,920,057 (GRCm39) E432G probably damaging Het
Gpld1 A T 13: 25,136,900 (GRCm39) S73C probably damaging Het
Hddc3 A G 7: 79,993,328 (GRCm39) I52V probably benign Het
Hmgcll1 A T 9: 75,991,732 (GRCm39) T252S probably damaging Het
Igsf10 G A 3: 59,243,843 (GRCm39) R164W probably damaging Het
Jph2 A G 2: 163,180,606 (GRCm39) V675A probably benign Het
Kifap3 T C 1: 163,689,666 (GRCm39) F550S probably benign Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Kplce C T 3: 92,775,951 (GRCm39) G244D probably benign Het
L1td1 T C 4: 98,625,932 (GRCm39) V643A possibly damaging Het
L3mbtl3 C T 10: 26,212,155 (GRCm39) M255I unknown Het
Layn T A 9: 50,968,837 (GRCm39) D302V probably damaging Het
Lpcat4 A G 2: 112,072,418 (GRCm39) I136V possibly damaging Het
Lrp1 T A 10: 127,382,807 (GRCm39) D3658V probably damaging Het
Metap1d T C 2: 71,352,900 (GRCm39) L243S possibly damaging Het
Midn T A 10: 79,990,275 (GRCm39) H315Q probably damaging Het
Mtrex A T 13: 113,050,888 (GRCm39) probably null Het
Myb C T 10: 21,030,612 (GRCm39) D62N probably benign Het
Myh2 T C 11: 67,077,522 (GRCm39) S886P probably benign Het
Nemf T C 12: 69,388,093 (GRCm39) I396V probably damaging Het
Nemp1 T G 10: 127,525,227 (GRCm39) V127G possibly damaging Het
Nkx3-1 C T 14: 69,428,227 (GRCm39) T25M possibly damaging Het
Nmral1 A C 16: 4,531,631 (GRCm39) L208R probably damaging Het
Nol6 A T 4: 41,116,422 (GRCm39) I989N probably benign Het
Or12e7 T A 2: 87,287,907 (GRCm39) C133S possibly damaging Het
Palld A T 8: 62,173,571 (GRCm39) S363T probably damaging Het
Pcdha11 A G 18: 37,144,512 (GRCm39) D201G probably damaging Het
Per2 A G 1: 91,366,081 (GRCm39) C339R probably damaging Het
Phactr4 T C 4: 132,097,874 (GRCm39) T455A possibly damaging Het
Phc2 T C 4: 128,617,062 (GRCm39) I445T probably damaging Het
Pmepa1 T C 2: 173,117,962 (GRCm39) T6A probably benign Het
Polr1a T C 6: 71,931,755 (GRCm39) F945L probably damaging Het
Ppp2r5e T A 12: 75,640,063 (GRCm39) K13* probably null Het
Ptafr T C 4: 132,306,613 (GRCm39) M1T probably null Het
Rbms1 G A 2: 60,610,087 (GRCm39) P208S probably benign Het
Scg3 T A 9: 75,558,955 (GRCm39) I419F probably damaging Het
Scn1a T C 2: 66,130,099 (GRCm39) T219A probably benign Het
Sec14l4 A G 11: 3,989,977 (GRCm39) D92G probably damaging Het
Senp3 G T 11: 69,569,085 (GRCm39) Q359K probably damaging Het
Sirt1 T C 10: 63,172,857 (GRCm39) D142G probably damaging Het
Skint2 T C 4: 112,483,039 (GRCm39) M148T possibly damaging Het
Slc30a10 T A 1: 185,187,391 (GRCm39) M44K probably damaging Het
Snai2 T A 16: 14,524,792 (GRCm39) D99E probably damaging Het
Spg7 A G 8: 123,807,408 (GRCm39) K395E possibly damaging Het
Sphk2 G A 7: 45,360,337 (GRCm39) H556Y possibly damaging Het
Supt6 A C 11: 78,116,612 (GRCm39) F637L probably benign Het
Tcam1 A G 11: 106,177,292 (GRCm39) N428S probably damaging Het
Tctn3 C T 19: 40,596,692 (GRCm39) R276K probably benign Het
Timm29 G A 9: 21,504,656 (GRCm39) R108H probably damaging Het
Tlr9 A T 9: 106,102,752 (GRCm39) E681V possibly damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tns3 T C 11: 8,400,094 (GRCm39) K1169E probably damaging Het
Trim72 A C 7: 127,608,315 (GRCm39) D271A possibly damaging Het
Trpv4 A T 5: 114,772,622 (GRCm39) D369E probably benign Het
Ttn A G 2: 76,583,192 (GRCm39) L22567P probably damaging Het
Uimc1 G A 13: 55,223,652 (GRCm39) P207S probably damaging Het
Unc5d A T 8: 29,165,448 (GRCm39) V781E probably damaging Het
Upk3bl C T 5: 136,086,076 (GRCm39) P4L unknown Het
Vmn1r201 A G 13: 22,659,670 (GRCm39) N295D probably benign Het
Vmn2r69 A G 7: 85,064,697 (GRCm39) I63T probably benign Het
Zfyve28 T C 5: 34,374,788 (GRCm39) T409A probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGCCAACCAAGCAG -3'
(R):5'- GCGAGCTCATTTCCCTAAAAGG -3'

Sequencing Primer
(F):5'- GCTCCCAGCTTCCCACAC -3'
(R):5'- GAGAGCGCCTCCCCTTC -3'
Posted On 2022-02-07