Incidental Mutation 'R0759:Pdilt'
ID70007
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Nameprotein disulfide isomerase-like, testis expressed
SynonymsPDILT, 1700007B13Rik
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119486587-119523489 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119489484 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 431 (Y431*)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000208275]
Predicted Effect probably null
Transcript: ENSMUST00000033267
AA Change: Y431*
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: Y431*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208275
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119500444 missense probably damaging 1.00
IGL02102:Pdilt APN 7 119486950 missense probably benign 0.28
IGL02312:Pdilt APN 7 119519667 missense probably benign 0.03
IGL02887:Pdilt APN 7 119498049 missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119500428 missense probably benign 0.03
R1525:Pdilt UTSW 7 119487994 missense probably damaging 0.99
R1612:Pdilt UTSW 7 119486975 missense possibly damaging 0.95
R1633:Pdilt UTSW 7 119487994 missense probably damaging 1.00
R1848:Pdilt UTSW 7 119489384 missense probably benign 0.02
R3026:Pdilt UTSW 7 119514954 missense probably benign 0.01
R3546:Pdilt UTSW 7 119500488 nonsense probably null
R4406:Pdilt UTSW 7 119495009 missense probably damaging 1.00
R5331:Pdilt UTSW 7 119514924 missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119486935 missense probably benign 0.01
R5771:Pdilt UTSW 7 119494994 missense probably damaging 0.98
R5807:Pdilt UTSW 7 119500543 unclassified probably benign
R6143:Pdilt UTSW 7 119495042 missense probably damaging 1.00
R6456:Pdilt UTSW 7 119500483 missense probably damaging 0.99
R6850:Pdilt UTSW 7 119486959 missense probably damaging 0.98
R7159:Pdilt UTSW 7 119487951 missense probably benign 0.01
R7676:Pdilt UTSW 7 119494997 missense probably damaging 1.00
R8266:Pdilt UTSW 7 119489381 missense probably benign 0.01
R8282:Pdilt UTSW 7 119498070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGAAAGCTTCAGCCTCTGTCC -3'
(R):5'- CCTGCTGAGCAGATACACGGTAAG -3'

Sequencing Primer
(F):5'- CTGGAGAGAAGCTGCGTTC -3'
(R):5'- CAGATACACGGTAAGAAGACAGC -3'
Posted On2013-09-30