Incidental Mutation 'R0759:A430078G23Rik'
ID70008
Institutional Source Beutler Lab
Gene Symbol A430078G23Rik
Ensembl Gene ENSMUSG00000074497
Gene NameRIKEN cDNA A430078G23 gene
Synonyms
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3353415-3390299 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to G at 3388822 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684] [ENSMUST00000098966] [ENSMUST00000145394] [ENSMUST00000208363]
Predicted Effect probably benign
Transcript: ENSMUST00000004684
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000098966
AA Change: I393S
SMART Domains Protein: ENSMUSP00000096566
Gene: ENSMUSG00000074497
AA Change: I393S

DomainStartEndE-ValueType
low complexity region 116 134 N/A INTRINSIC
low complexity region 291 308 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect probably benign
Transcript: ENSMUST00000145394
Predicted Effect probably benign
Transcript: ENSMUST00000208363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208845
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in A430078G23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:A430078G23Rik APN 8 3381942 missense possibly damaging 0.62
IGL01743:A430078G23Rik APN 8 3364697 missense probably benign 0.01
IGL03334:A430078G23Rik APN 8 3388023 missense probably benign 0.04
R0417:A430078G23Rik UTSW 8 3388957 utr 3 prime probably benign
R0646:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R0880:A430078G23Rik UTSW 8 3389032 utr 3 prime probably benign
R0980:A430078G23Rik UTSW 8 3389095 utr 3 prime probably benign
R1175:A430078G23Rik UTSW 8 3389023 utr 3 prime probably benign
R1649:A430078G23Rik UTSW 8 3389094 utr 3 prime probably benign
R1781:A430078G23Rik UTSW 8 3380495 missense probably damaging 0.98
R2211:A430078G23Rik UTSW 8 3387680 missense possibly damaging 0.95
R2843:A430078G23Rik UTSW 8 3364634 missense possibly damaging 0.82
R5319:A430078G23Rik UTSW 8 3385010 critical splice donor site probably null
R5415:A430078G23Rik UTSW 8 3388075 missense probably damaging 0.99
R5588:A430078G23Rik UTSW 8 3388878 utr 3 prime probably benign
R6455:A430078G23Rik UTSW 8 3388753 missense probably benign 0.16
R7573:A430078G23Rik UTSW 8 3384918 missense probably damaging 0.96
R7664:A430078G23Rik UTSW 8 3386390 missense probably damaging 0.98
R7731:A430078G23Rik UTSW 8 3384936 missense probably damaging 0.99
R7845:A430078G23Rik UTSW 8 3386959 missense probably damaging 0.99
R8167:A430078G23Rik UTSW 8 3353636 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGACCCGTTGGGCACTGAAGA -3'
(R):5'- TCACACATTAAACCATGATGGAAAGGCA -3'

Sequencing Primer
(F):5'- CTGGACTCAGGCAGAGTATTTATC -3'
(R):5'- GCATACGAGGAAAGACTGCC -3'
Posted On2013-09-30