Incidental Mutation 'R0759:Elavl1'
ID70009
Institutional Source Beutler Lab
Gene Symbol Elavl1
Ensembl Gene ENSMUSG00000040028
Gene NameELAV (embryonic lethal, abnormal vision)-like 1 (Hu antigen R)
SynonymsW91709, 2410055N02Rik, Hua, HuR
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location4285382-4325413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4289815 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 256 (D256Y)
Ref Sequence ENSEMBL: ENSMUSP00000146866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098950] [ENSMUST00000209010]
Predicted Effect probably damaging
Transcript: ENSMUST00000098950
AA Change: D256Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096549
Gene: ENSMUSG00000040028
AA Change: D256Y

DomainStartEndE-ValueType
RRM 21 94 1.3e-22 SMART
RRM 107 182 1.91e-20 SMART
RRM 245 318 6.15e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209010
AA Change: D256Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to placental failure resulting from extraembryonic trophoblast defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Elavl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Elavl1 APN 8 4301699 missense probably damaging 1.00
IGL02409:Elavl1 APN 8 4289838 missense possibly damaging 0.88
R2322:Elavl1 UTSW 8 4289802 missense probably damaging 1.00
R4205:Elavl1 UTSW 8 4289851 missense probably damaging 0.99
R4946:Elavl1 UTSW 8 4301752 missense probably benign 0.05
R5009:Elavl1 UTSW 8 4301723 missense probably benign 0.00
R5073:Elavl1 UTSW 8 4301741 missense possibly damaging 0.79
R6614:Elavl1 UTSW 8 4289818 missense probably damaging 1.00
R7200:Elavl1 UTSW 8 4311767 missense probably benign 0.00
R7204:Elavl1 UTSW 8 4311712 missense probably damaging 0.98
R7305:Elavl1 UTSW 8 4325199 unclassified probably benign
R7881:Elavl1 UTSW 8 4311763 missense probably damaging 1.00
R7903:Elavl1 UTSW 8 4301756 missense probably benign 0.28
R8310:Elavl1 UTSW 8 4301786 missense probably damaging 0.99
R8372:Elavl1 UTSW 8 4289664 missense probably damaging 1.00
R8390:Elavl1 UTSW 8 4289623 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACATGTCGGTTGCATCCCAGAG -3'
(R):5'- GCTGGCCTTAACCTTGACCTGAAC -3'

Sequencing Primer
(F):5'- agaaggaaagaaaaaaaaaGCATGAG -3'
(R):5'- TAACCTTGACCTGAACATGTGC -3'
Posted On2013-09-30