Incidental Mutation 'R9229:Nlrp2'
ID 700090
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9229 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 5298547-5351035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 5301053 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 953 (T953S)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022] [ENSMUST00000207520] [ENSMUST00000207685]
AlphaFold Q4PLS0
Predicted Effect possibly damaging
Transcript: ENSMUST00000045022
AA Change: T953S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: T953S

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000207520
AA Change: T158S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000207685
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,462,378 M124I probably damaging Het
2310035C23Rik A T 1: 105,686,984 I218F possibly damaging Het
Actr10 A G 12: 70,943,485 T104A probably damaging Het
Agbl1 G A 7: 77,124,522 V1065I unknown Het
Agpat1 G T 17: 34,611,689 V196L probably null Het
Agxt2 T A 15: 10,409,511 V499E probably damaging Het
Amy2a1 T A 3: 113,532,306 probably benign Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Arhgef18 T A 8: 3,429,314 S51T probably benign Het
Armc12 A C 17: 28,532,371 D113A probably benign Het
Armc4 C A 18: 7,127,324 R963L possibly damaging Het
Azin1 T A 15: 38,490,402 I436F probably benign Het
B3galnt2 T C 13: 13,991,522 V334A probably damaging Het
BC055324 A T 1: 163,967,090 W512R probably damaging Het
C87414 A T 5: 93,636,230 C458* probably null Het
Ccdc68 C T 18: 69,947,132 H183Y probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cemip A T 7: 83,957,625 W795R probably damaging Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Ciao1 G C 2: 127,247,142 C52W probably damaging Het
Cmya5 A G 13: 93,095,668 S971P possibly damaging Het
Cnot2 A T 10: 116,549,055 L9* probably null Het
Coro1c G T 5: 113,865,686 H91N probably damaging Het
Crbn A T 6: 106,800,056 M1K probably null Het
Ctsb T A 14: 63,135,663 W90R probably damaging Het
Ctse A G 1: 131,668,124 I185V probably damaging Het
Dennd1b G T 1: 139,053,362 E105* probably null Het
Exoc5 G A 14: 49,014,253 Q679* probably null Het
Gabrg3 G A 7: 56,724,520 R433C probably damaging Het
Gm10354 A T 5: 14,977,704 S53T probably benign Het
Gm8994 A G 6: 136,329,143 I201V possibly damaging Het
Gria2 C A 3: 80,802,382 M1I probably null Het
Hist1h1t T C 13: 23,696,046 S61P probably damaging Het
Hoxb6 A T 11: 96,300,819 Q189L probably damaging Het
Hoxd10 A G 2: 74,694,256 N304S possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Htra4 A T 8: 25,038,541 C112S probably damaging Het
Ide T C 19: 37,284,199 T715A Het
Ipo13 A T 4: 117,901,604 I688N probably damaging Het
Irs2 A C 8: 11,007,400 L344R probably damaging Het
Kat6a A G 8: 22,939,971 T1781A unknown Het
Lin7a G T 10: 107,411,983 V172L probably damaging Het
Lpcat1 G T 13: 73,505,531 E282D probably damaging Het
Mcf2l A G 8: 13,013,584 T963A probably benign Het
Mfsd14a G A 3: 116,645,469 A128V probably benign Het
Mfsd6 C G 1: 52,708,744 G321R probably damaging Het
Mill2 C T 7: 18,856,550 T185I probably damaging Het
Mkl2 G T 16: 13,412,321 A957S possibly damaging Het
Mpped1 C T 15: 83,854,472 T270I possibly damaging Het
Myh9 T A 15: 77,790,817 Y300F possibly damaging Het
Nlrp4e T A 7: 23,321,374 S429T probably benign Het
Nphp3 T A 9: 104,036,177 Y1003N probably damaging Het
Nrap T C 19: 56,321,907 K1588R probably benign Het
Olfr1118 G A 2: 87,308,821 V31I probably benign Het
Olfr1489 T A 19: 13,634,050 V313D probably damaging Het
Pam A G 1: 97,825,935 V870A probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plin3 A T 17: 56,284,315 V155E probably damaging Het
Pnpla7 G A 2: 24,983,491 V170I probably damaging Het
Ptprz1 A G 6: 22,986,284 H361R probably null Het
Pvalb T A 15: 78,202,567 I50F possibly damaging Het
Rhag G A 17: 40,831,190 A175T probably damaging Het
Slc24a4 T C 12: 102,234,724 V291A possibly damaging Het
Slc9b2 G A 3: 135,336,534 E525K probably benign Het
Smg7 A G 1: 152,845,220 F747S possibly damaging Het
Sorcs1 T G 19: 50,152,862 I1144L probably benign Het
Sox1 A T 8: 12,397,390 I344F possibly damaging Het
Spta1 A T 1: 174,240,184 E2059V probably damaging Het
Sva T A 6: 42,040,116 N52K possibly damaging Het
Sva T A 6: 42,040,118 M53K probably benign Het
Thsd7b A G 1: 129,921,290 Y913C probably damaging Het
Tiam1 A G 16: 89,837,831 S864P possibly damaging Het
Tma16 A G 8: 66,484,127 V16A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Treml1 A G 17: 48,366,746 S262G probably benign Het
Ttn A T 2: 76,767,453 D19705E probably benign Het
Utp20 A G 10: 88,758,377 L2162P possibly damaging Het
Vmn2r60 A G 7: 42,142,299 I549V possibly damaging Het
Xpo4 T C 14: 57,613,699 N329S probably benign Het
Zfp879 T A 11: 50,833,059 H390L probably damaging Het
Zranb1 C T 7: 132,981,388 S512F probably damaging Het
Zswim8 A G 14: 20,716,325 H847R probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5327549 missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5327888 missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5324979 missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5322458 missense probably null 0.00
R9038:Nlrp2 UTSW 7 5327479 missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5327573 missense probably benign 0.01
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCGGAAATAGTGGGATCACACC -3'
(R):5'- AAATGGCATCCAGTTCCCC -3'

Sequencing Primer
(F):5'- GTGGGATCACACCTAAGCATTTGC -3'
(R):5'- GTTCCCCCATGAGAAAACTTTC -3'
Posted On 2022-02-07