Incidental Mutation 'R0759:Smpd3'
ID70011
Institutional Source Beutler Lab
Gene Symbol Smpd3
Ensembl Gene ENSMUSG00000031906
Gene Namesphingomyelin phosphodiesterase 3, neutral
Synonymsneutral sphingomyelinase II, nSMase2, fro, 4631433G07Rik
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106252548-106337988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106265228 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 231 (E231G)
Ref Sequence ENSEMBL: ENSMUSP00000148282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067512] [ENSMUST00000212896]
Predicted Effect probably benign
Transcript: ENSMUST00000067512
AA Change: E231G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069255
Gene: ENSMUSG00000031906
AA Change: E231G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Pfam:Exo_endo_phos 321 639 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Predicted Effect probably benign
Transcript: ENSMUST00000212896
AA Change: E231G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit dwarfism, delayed sexual and gonad maturation, delayed ossification of the long bones, and reduced serum levels of thyroxine, triiodothyronine, cortisol, and insulin-like growth factor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Smpd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03380:Smpd3 APN 8 106259659 missense probably benign 0.01
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0240:Smpd3 UTSW 8 106265156 missense probably damaging 0.96
R0456:Smpd3 UTSW 8 106259656 missense probably benign
R0799:Smpd3 UTSW 8 106264789 missense possibly damaging 0.92
R1544:Smpd3 UTSW 8 106265567 missense possibly damaging 0.70
R1756:Smpd3 UTSW 8 106264971 missense probably benign
R2937:Smpd3 UTSW 8 106264820 missense probably damaging 1.00
R2939:Smpd3 UTSW 8 106257407 missense probably benign 0.00
R4614:Smpd3 UTSW 8 106259739 missense probably damaging 1.00
R5829:Smpd3 UTSW 8 106264880 missense probably benign 0.15
R6822:Smpd3 UTSW 8 106265964 start gained probably benign
R6891:Smpd3 UTSW 8 106264668 missense probably damaging 1.00
R6962:Smpd3 UTSW 8 106265219 missense probably benign 0.34
R6965:Smpd3 UTSW 8 106259881 missense probably damaging 1.00
R7344:Smpd3 UTSW 8 106265193 missense probably damaging 1.00
R7394:Smpd3 UTSW 8 106265010 missense probably damaging 0.99
R7823:Smpd3 UTSW 8 106255622 missense probably benign
R7825:Smpd3 UTSW 8 106255622 missense probably benign
Z1177:Smpd3 UTSW 8 106264842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCACAGAGGTCTTATACAGCAGC -3'
(R):5'- TTGGGCAGAGAATCCGCAATGG -3'

Sequencing Primer
(F):5'- AGCAGCTTGCTGTTAGCC -3'
(R):5'- GGCCTCAGATCAAGATCTACATCG -3'
Posted On2013-09-30