Incidental Mutation 'R9229:Xpo4'
ID 700121
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.736) question?
Stock # R9229 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57577521-57665430 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57613699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 329 (N329S)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174152] [ENSMUST00000174545]
AlphaFold Q9ESJ0
Predicted Effect probably benign
Transcript: ENSMUST00000089482
AA Change: N329S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: N329S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174152
Predicted Effect probably benign
Transcript: ENSMUST00000174545
AA Change: N329S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: N329S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,462,378 M124I probably damaging Het
2310035C23Rik A T 1: 105,686,984 I218F possibly damaging Het
Actr10 A G 12: 70,943,485 T104A probably damaging Het
Agbl1 G A 7: 77,124,522 V1065I unknown Het
Agpat1 G T 17: 34,611,689 V196L probably null Het
Agxt2 T A 15: 10,409,511 V499E probably damaging Het
Amy2a1 T A 3: 113,532,306 probably benign Het
Ankrd35 A G 3: 96,684,899 T834A probably benign Het
Arhgef18 T A 8: 3,429,314 S51T probably benign Het
Armc12 A C 17: 28,532,371 D113A probably benign Het
Armc4 C A 18: 7,127,324 R963L possibly damaging Het
Azin1 T A 15: 38,490,402 I436F probably benign Het
B3galnt2 T C 13: 13,991,522 V334A probably damaging Het
BC055324 A T 1: 163,967,090 W512R probably damaging Het
C87414 A T 5: 93,636,230 C458* probably null Het
Ccdc68 C T 18: 69,947,132 H183Y probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cemip A T 7: 83,957,625 W795R probably damaging Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Ciao1 G C 2: 127,247,142 C52W probably damaging Het
Cmya5 A G 13: 93,095,668 S971P possibly damaging Het
Cnot2 A T 10: 116,549,055 L9* probably null Het
Coro1c G T 5: 113,865,686 H91N probably damaging Het
Crbn A T 6: 106,800,056 M1K probably null Het
Ctsb T A 14: 63,135,663 W90R probably damaging Het
Ctse A G 1: 131,668,124 I185V probably damaging Het
Dennd1b G T 1: 139,053,362 E105* probably null Het
Exoc5 G A 14: 49,014,253 Q679* probably null Het
Gabrg3 G A 7: 56,724,520 R433C probably damaging Het
Gm10354 A T 5: 14,977,704 S53T probably benign Het
Gm8994 A G 6: 136,329,143 I201V possibly damaging Het
Gria2 C A 3: 80,802,382 M1I probably null Het
Hist1h1t T C 13: 23,696,046 S61P probably damaging Het
Hoxb6 A T 11: 96,300,819 Q189L probably damaging Het
Hoxd10 A G 2: 74,694,256 N304S possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Htra4 A T 8: 25,038,541 C112S probably damaging Het
Ide T C 19: 37,284,199 T715A Het
Ipo13 A T 4: 117,901,604 I688N probably damaging Het
Irs2 A C 8: 11,007,400 L344R probably damaging Het
Kat6a A G 8: 22,939,971 T1781A unknown Het
Lin7a G T 10: 107,411,983 V172L probably damaging Het
Lpcat1 G T 13: 73,505,531 E282D probably damaging Het
Mcf2l A G 8: 13,013,584 T963A probably benign Het
Mfsd14a G A 3: 116,645,469 A128V probably benign Het
Mfsd6 C G 1: 52,708,744 G321R probably damaging Het
Mill2 C T 7: 18,856,550 T185I probably damaging Het
Mkl2 G T 16: 13,412,321 A957S possibly damaging Het
Mpped1 C T 15: 83,854,472 T270I possibly damaging Het
Myh9 T A 15: 77,790,817 Y300F possibly damaging Het
Nlrp2 T A 7: 5,301,053 T953S possibly damaging Het
Nlrp4e T A 7: 23,321,374 S429T probably benign Het
Nphp3 T A 9: 104,036,177 Y1003N probably damaging Het
Nrap T C 19: 56,321,907 K1588R probably benign Het
Olfr1118 G A 2: 87,308,821 V31I probably benign Het
Olfr1489 T A 19: 13,634,050 V313D probably damaging Het
Pam A G 1: 97,825,935 V870A probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plin3 A T 17: 56,284,315 V155E probably damaging Het
Pmepa1 T C 2: 173,276,169 T6A probably benign Het
Pnpla7 G A 2: 24,983,491 V170I probably damaging Het
Ptprz1 A G 6: 22,986,284 H361R probably null Het
Pvalb T A 15: 78,202,567 I50F possibly damaging Het
Rhag G A 17: 40,831,190 A175T probably damaging Het
Slc24a4 T C 12: 102,234,724 V291A possibly damaging Het
Slc9b2 G A 3: 135,336,534 E525K probably benign Het
Smg7 A G 1: 152,845,220 F747S possibly damaging Het
Sorcs1 T G 19: 50,152,862 I1144L probably benign Het
Sox1 A T 8: 12,397,390 I344F possibly damaging Het
Spta1 A T 1: 174,240,184 E2059V probably damaging Het
Sva T A 6: 42,040,116 N52K possibly damaging Het
Sva T A 6: 42,040,118 M53K probably benign Het
Thsd7b A G 1: 129,921,290 Y913C probably damaging Het
Tiam1 A G 16: 89,837,831 S864P possibly damaging Het
Tma16 A G 8: 66,484,127 V16A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Treml1 A G 17: 48,366,746 S262G probably benign Het
Ttn A T 2: 76,767,453 D19705E probably benign Het
Utp20 A G 10: 88,758,377 L2162P possibly damaging Het
Vmn2r60 A G 7: 42,142,299 I549V possibly damaging Het
Zfp879 T A 11: 50,833,059 H390L probably damaging Het
Zranb1 C T 7: 132,981,388 S512F probably damaging Het
Zswim8 A G 14: 20,716,325 H847R probably benign Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57604398 missense probably benign
IGL02537:Xpo4 APN 14 57593833 missense probably benign
IGL02554:Xpo4 APN 14 57590088 missense probably benign 0.00
IGL02826:Xpo4 APN 14 57629420 missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57618228 missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57584611 missense probably null 0.98
R0245:Xpo4 UTSW 14 57630240 missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57613274 missense probably benign 0.07
R0606:Xpo4 UTSW 14 57638208 unclassified probably benign
R0761:Xpo4 UTSW 14 57613383 missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57603672 missense probably benign
R1853:Xpo4 UTSW 14 57585907 missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57590871 missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57586644 missense probably null 0.19
R2035:Xpo4 UTSW 14 57585926 missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57590090 missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57629503 missense probably benign 0.00
R2937:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R2938:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R4066:Xpo4 UTSW 14 57588054 missense probably benign 0.07
R4086:Xpo4 UTSW 14 57643033 intron probably benign
R4373:Xpo4 UTSW 14 57591022 nonsense probably null
R4620:Xpo4 UTSW 14 57630325 missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57590108 missense probably benign 0.01
R4755:Xpo4 UTSW 14 57618181 missense probably benign 0.01
R4831:Xpo4 UTSW 14 57590102 missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57638289 missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57638240 missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57584641 missense probably benign 0.02
R5279:Xpo4 UTSW 14 57613409 missense probably benign 0.37
R5375:Xpo4 UTSW 14 57638307 missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57590989 missense probably benign 0.03
R5936:Xpo4 UTSW 14 57643499 missense probably benign
R6393:Xpo4 UTSW 14 57638313 missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57613403 missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57582310 missense probably benign
R6923:Xpo4 UTSW 14 57603711 missense probably benign 0.19
R7028:Xpo4 UTSW 14 57597051 missense probably benign 0.22
R7442:Xpo4 UTSW 14 57630223 missense probably benign 0.00
R7469:Xpo4 UTSW 14 57597979 missense probably benign
R7490:Xpo4 UTSW 14 57602621 frame shift probably null
R7622:Xpo4 UTSW 14 57597011 missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57589959 missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57613349 missense probably benign 0.00
R7895:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R8000:Xpo4 UTSW 14 57589946 missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57597884 critical splice donor site probably null
R8395:Xpo4 UTSW 14 57648467 missense probably benign 0.01
R8420:Xpo4 UTSW 14 57604456 missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57664910 missense probably benign 0.03
R8841:Xpo4 UTSW 14 57597956 missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57591018 missense probably benign 0.00
R9374:Xpo4 UTSW 14 57591055 missense possibly damaging 0.94
R9551:Xpo4 UTSW 14 57591055 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GATCCCTACGGCTTCAGAATCTTC -3'
(R):5'- ACATGGTTCTCACGTGACCC -3'

Sequencing Primer
(F):5'- CACTCATTCATTTCTAAAGGCACATC -3'
(R):5'- GTGACCCCTACAAAAGAAGAATTTG -3'
Posted On 2022-02-07