Incidental Mutation 'R9229:Xpo4'
ID 700121
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms B430309A01Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.722) question?
Stock # R9229 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57814978-57902887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57851156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 329 (N329S)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174152] [ENSMUST00000174545]
AlphaFold Q9ESJ0
Predicted Effect probably benign
Transcript: ENSMUST00000089482
AA Change: N329S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: N329S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174152
Predicted Effect probably benign
Transcript: ENSMUST00000174545
AA Change: N329S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: N329S

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr10 A G 12: 70,990,259 (GRCm39) T104A probably damaging Het
Agbl1 G A 7: 76,774,270 (GRCm39) V1065I unknown Het
Agpat1 G T 17: 34,830,663 (GRCm39) V196L probably null Het
Agxt2 T A 15: 10,409,597 (GRCm39) V499E probably damaging Het
Amy2a1 T A 3: 113,325,955 (GRCm39) probably benign Het
Ankrd35 A G 3: 96,592,215 (GRCm39) T834A probably benign Het
Arhgef18 T A 8: 3,479,314 (GRCm39) S51T probably benign Het
Armc12 A C 17: 28,751,345 (GRCm39) D113A probably benign Het
Azin1 T A 15: 38,490,646 (GRCm39) I436F probably benign Het
B3galnt2 T C 13: 14,166,107 (GRCm39) V334A probably damaging Het
Ccdc68 C T 18: 70,080,203 (GRCm39) H183Y probably benign Het
Cd180 TA TAA 13: 102,841,514 (GRCm39) probably null Het
Cemip A T 7: 83,606,833 (GRCm39) W795R probably damaging Het
Cenpj C T 14: 56,802,176 (GRCm39) E130K possibly damaging Het
Ciao1 G C 2: 127,089,062 (GRCm39) C52W probably damaging Het
Cmya5 A G 13: 93,232,176 (GRCm39) S971P possibly damaging Het
Cnot2 A T 10: 116,384,960 (GRCm39) L9* probably null Het
Coro1c G T 5: 114,003,747 (GRCm39) H91N probably damaging Het
Crbn A T 6: 106,777,017 (GRCm39) M1K probably null Het
Ctsb T A 14: 63,373,112 (GRCm39) W90R probably damaging Het
Ctse A G 1: 131,595,862 (GRCm39) I185V probably damaging Het
Dennd1b G T 1: 138,981,100 (GRCm39) E105* probably null Het
Eif4a3l1 A G 6: 136,306,141 (GRCm39) I201V possibly damaging Het
Exoc5 G A 14: 49,251,710 (GRCm39) Q679* probably null Het
Firrm A T 1: 163,794,659 (GRCm39) W512R probably damaging Het
Gabrg3 G A 7: 56,374,268 (GRCm39) R433C probably damaging Het
Gria2 C A 3: 80,709,689 (GRCm39) M1I probably null Het
H1f6 T C 13: 23,880,029 (GRCm39) S61P probably damaging Het
Hoxb6 A T 11: 96,191,645 (GRCm39) Q189L probably damaging Het
Hoxd10 A G 2: 74,524,600 (GRCm39) N304S possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Htra4 A T 8: 25,528,557 (GRCm39) C112S probably damaging Het
Ide T C 19: 37,261,598 (GRCm39) T715A Het
Ipo13 A T 4: 117,758,801 (GRCm39) I688N probably damaging Het
Irs2 A C 8: 11,057,400 (GRCm39) L344R probably damaging Het
Kat6a A G 8: 23,429,987 (GRCm39) T1781A unknown Het
Lin7a G T 10: 107,247,844 (GRCm39) V172L probably damaging Het
Lpcat1 G T 13: 73,653,650 (GRCm39) E282D probably damaging Het
Mcf2l A G 8: 13,063,584 (GRCm39) T963A probably benign Het
Mfsd14a G A 3: 116,439,118 (GRCm39) A128V probably benign Het
Mfsd6 C G 1: 52,747,903 (GRCm39) G321R probably damaging Het
Mill2 C T 7: 18,590,475 (GRCm39) T185I probably damaging Het
Mpped1 C T 15: 83,738,673 (GRCm39) T270I possibly damaging Het
Mrtfb G T 16: 13,230,185 (GRCm39) A957S possibly damaging Het
Myh9 T A 15: 77,675,017 (GRCm39) Y300F possibly damaging Het
Nlrp2 T A 7: 5,304,052 (GRCm39) T953S possibly damaging Het
Nlrp4e T A 7: 23,020,799 (GRCm39) S429T probably benign Het
Nphp3 T A 9: 103,913,376 (GRCm39) Y1003N probably damaging Het
Nrap T C 19: 56,310,339 (GRCm39) K1588R probably benign Het
Odad2 C A 18: 7,127,324 (GRCm39) R963L possibly damaging Het
Or10ag56 G A 2: 87,139,165 (GRCm39) V31I probably benign Het
Or5b124 T A 19: 13,611,414 (GRCm39) V313D probably damaging Het
Pam A G 1: 97,753,660 (GRCm39) V870A probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pierce1 C A 2: 28,352,390 (GRCm39) M124I probably damaging Het
Plin3 A T 17: 56,591,315 (GRCm39) V155E probably damaging Het
Pmepa1 T C 2: 173,117,962 (GRCm39) T6A probably benign Het
Pnpla7 G A 2: 24,873,503 (GRCm39) V170I probably damaging Het
Pramel34 A T 5: 93,784,089 (GRCm39) C458* probably null Het
Ptprz1 A G 6: 22,986,283 (GRCm39) H361R probably null Het
Pvalb T A 15: 78,086,767 (GRCm39) I50F possibly damaging Het
Relch A T 1: 105,614,709 (GRCm39) I218F possibly damaging Het
Rhag G A 17: 41,142,081 (GRCm39) A175T probably damaging Het
Slc24a4 T C 12: 102,200,983 (GRCm39) V291A possibly damaging Het
Slc9b2 G A 3: 135,042,295 (GRCm39) E525K probably benign Het
Smg7 A G 1: 152,720,971 (GRCm39) F747S possibly damaging Het
Sorcs1 T G 19: 50,141,300 (GRCm39) I1144L probably benign Het
Sox1 A T 8: 12,447,390 (GRCm39) I344F possibly damaging Het
Speer4e2 A T 5: 15,027,718 (GRCm39) S53T probably benign Het
Spta1 A T 1: 174,067,750 (GRCm39) E2059V probably damaging Het
Sva T A 6: 42,017,050 (GRCm39) N52K possibly damaging Het
Sva T A 6: 42,017,052 (GRCm39) M53K probably benign Het
Thsd7b A G 1: 129,849,027 (GRCm39) Y913C probably damaging Het
Tiam1 A G 16: 89,634,719 (GRCm39) S864P possibly damaging Het
Tma16 A G 8: 66,936,779 (GRCm39) V16A probably benign Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Treml1 A G 17: 48,673,774 (GRCm39) S262G probably benign Het
Ttn A T 2: 76,597,797 (GRCm39) D19705E probably benign Het
Utp20 A G 10: 88,594,239 (GRCm39) L2162P possibly damaging Het
Vmn2r60 A G 7: 41,791,723 (GRCm39) I549V possibly damaging Het
Zfp879 T A 11: 50,723,886 (GRCm39) H390L probably damaging Het
Zranb1 C T 7: 132,583,117 (GRCm39) S512F probably damaging Het
Zswim8 A G 14: 20,766,393 (GRCm39) H847R probably benign Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57,841,855 (GRCm39) missense probably benign
IGL02537:Xpo4 APN 14 57,831,290 (GRCm39) missense probably benign
IGL02554:Xpo4 APN 14 57,827,545 (GRCm39) missense probably benign 0.00
IGL02826:Xpo4 APN 14 57,866,877 (GRCm39) missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57,855,685 (GRCm39) missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57,822,068 (GRCm39) missense probably null 0.98
R0245:Xpo4 UTSW 14 57,867,697 (GRCm39) missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57,850,731 (GRCm39) missense probably benign 0.07
R0606:Xpo4 UTSW 14 57,875,665 (GRCm39) unclassified probably benign
R0761:Xpo4 UTSW 14 57,850,840 (GRCm39) missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57,841,129 (GRCm39) missense probably benign
R1853:Xpo4 UTSW 14 57,823,364 (GRCm39) missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57,828,328 (GRCm39) missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57,824,101 (GRCm39) missense probably null 0.19
R2035:Xpo4 UTSW 14 57,823,383 (GRCm39) missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57,827,547 (GRCm39) missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57,866,960 (GRCm39) missense probably benign 0.00
R2937:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R2938:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R4066:Xpo4 UTSW 14 57,825,511 (GRCm39) missense probably benign 0.07
R4086:Xpo4 UTSW 14 57,880,490 (GRCm39) intron probably benign
R4373:Xpo4 UTSW 14 57,828,479 (GRCm39) nonsense probably null
R4620:Xpo4 UTSW 14 57,867,782 (GRCm39) missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57,827,565 (GRCm39) missense probably benign 0.01
R4755:Xpo4 UTSW 14 57,855,638 (GRCm39) missense probably benign 0.01
R4831:Xpo4 UTSW 14 57,827,559 (GRCm39) missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57,875,746 (GRCm39) missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57,875,697 (GRCm39) missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57,822,098 (GRCm39) missense probably benign 0.02
R5279:Xpo4 UTSW 14 57,850,866 (GRCm39) missense probably benign 0.37
R5375:Xpo4 UTSW 14 57,875,764 (GRCm39) missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57,828,446 (GRCm39) missense probably benign 0.03
R5936:Xpo4 UTSW 14 57,880,956 (GRCm39) missense probably benign
R6393:Xpo4 UTSW 14 57,875,770 (GRCm39) missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57,850,860 (GRCm39) missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57,819,767 (GRCm39) missense probably benign
R6923:Xpo4 UTSW 14 57,841,168 (GRCm39) missense probably benign 0.19
R7028:Xpo4 UTSW 14 57,834,508 (GRCm39) missense probably benign 0.22
R7442:Xpo4 UTSW 14 57,867,680 (GRCm39) missense probably benign 0.00
R7469:Xpo4 UTSW 14 57,835,436 (GRCm39) missense probably benign
R7490:Xpo4 UTSW 14 57,840,078 (GRCm39) frame shift probably null
R7622:Xpo4 UTSW 14 57,834,468 (GRCm39) missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57,827,416 (GRCm39) missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57,850,806 (GRCm39) missense probably benign 0.00
R7895:Xpo4 UTSW 14 57,840,048 (GRCm39) missense probably benign 0.03
R8000:Xpo4 UTSW 14 57,827,403 (GRCm39) missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57,835,341 (GRCm39) critical splice donor site probably null
R8395:Xpo4 UTSW 14 57,885,924 (GRCm39) missense probably benign 0.01
R8420:Xpo4 UTSW 14 57,841,913 (GRCm39) missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57,902,367 (GRCm39) missense probably benign 0.03
R8841:Xpo4 UTSW 14 57,835,413 (GRCm39) missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57,828,475 (GRCm39) missense probably benign 0.00
R9374:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9551:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9628:Xpo4 UTSW 14 57,842,630 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCCTACGGCTTCAGAATCTTC -3'
(R):5'- ACATGGTTCTCACGTGACCC -3'

Sequencing Primer
(F):5'- CACTCATTCATTTCTAAAGGCACATC -3'
(R):5'- GTGACCCCTACAAAAGAAGAATTTG -3'
Posted On 2022-02-07