Incidental Mutation 'R0759:Colec11'
ID70015
Institutional Source Beutler Lab
Gene Symbol Colec11
Ensembl Gene ENSMUSG00000036655
Gene Namecollectin sub-family member 11
Synonyms
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location28594173-28623377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28594731 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000049285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036136] [ENSMUST00000220655] [ENSMUST00000220836]
Predicted Effect probably damaging
Transcript: ENSMUST00000036136
AA Change: S249P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049285
Gene: ENSMUSG00000036655
AA Change: S249P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Collagen 40 88 5.8e-10 PFAM
Pfam:Collagen 60 116 4.7e-11 PFAM
CLECT 139 266 1.74e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220655
Predicted Effect probably damaging
Transcript: ENSMUST00000220836
AA Change: S255P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in the human gene are a cause of 3MC syndrome-2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased susceptibility to kidney reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Colec11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Colec11 APN 12 28594868 missense probably damaging 1.00
IGL01990:Colec11 APN 12 28594986 missense probably benign 0.30
philatelist UTSW 12 28595242 critical splice donor site probably null
R1796:Colec11 UTSW 12 28594859 missense probably damaging 1.00
R2086:Colec11 UTSW 12 28594787 missense probably damaging 0.99
R2926:Colec11 UTSW 12 28617429 missense probably damaging 0.99
R3624:Colec11 UTSW 12 28594908 missense probably benign 0.00
R4078:Colec11 UTSW 12 28595247 missense possibly damaging 0.75
R5680:Colec11 UTSW 12 28594731 missense probably damaging 1.00
R6768:Colec11 UTSW 12 28595101 splice site probably null
R7296:Colec11 UTSW 12 28594715 missense probably damaging 1.00
R7758:Colec11 UTSW 12 28595242 critical splice donor site probably null
R7899:Colec11 UTSW 12 28595282 missense probably damaging 1.00
R8384:Colec11 UTSW 12 28594659 makesense probably null
RF019:Colec11 UTSW 12 28612883 missense probably benign 0.29
Z1176:Colec11 UTSW 12 28595284 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCAAGGTTTCTCCCCTCCTACG -3'
(R):5'- GCCAATGGCCTGATGGCTTCATAC -3'

Sequencing Primer
(F):5'- AACTGTCAATGAGGCCCG -3'
(R):5'- ATGGCTTCATACCTGGCACAG -3'
Posted On2013-09-30