Incidental Mutation 'R9230:Glis1'
ID 700157
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene Name GLIS family zinc finger 1
Synonyms GliH1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9230 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 107291788-107492258 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107425327 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 313 (S313P)
Ref Sequence ENSEMBL: ENSMUSP00000035650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738] [ENSMUST00000135835]
AlphaFold Q8K1M4
Predicted Effect probably benign
Transcript: ENSMUST00000046005
AA Change: S313P

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: S313P

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106738
AA Change: S125P

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: S125P

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135835
SMART Domains Protein: ENSMUSP00000118600
Gene: ENSMUSG00000034762

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,157,626 (GRCm39) F274I probably damaging Het
Aen T A 7: 78,552,107 (GRCm39) D22E probably damaging Het
Appl1 T C 14: 26,645,692 (GRCm39) E706G unknown Het
Arhgap21 T C 2: 20,860,469 (GRCm39) T1313A possibly damaging Het
Armc2 T C 10: 41,823,935 (GRCm39) Y511C probably damaging Het
Bsn T C 9: 107,989,459 (GRCm39) T2098A probably damaging Het
Cacna1h T C 17: 25,599,856 (GRCm39) Y1659C probably damaging Het
Catsperb T C 12: 101,516,053 (GRCm39) I563T probably benign Het
Cblif G A 19: 11,737,748 (GRCm39) W386* probably null Het
Cd180 TA TAA 13: 102,841,514 (GRCm39) probably null Het
Cd55b A T 1: 130,350,619 (GRCm39) L26* probably null Het
Cdc42bpa A G 1: 179,933,638 (GRCm39) N759S probably benign Het
Chrm3 C A 13: 9,928,479 (GRCm39) V186L probably benign Het
Clrn2 A G 5: 45,621,283 (GRCm39) T226A probably damaging Het
Col3a1 C T 1: 45,383,138 (GRCm39) P1071S unknown Het
Csgalnact2 A G 6: 118,103,212 (GRCm39) L250P probably damaging Het
Cyp4a31 G T 4: 115,428,281 (GRCm39) E326* probably null Het
Def8 A G 8: 124,186,317 (GRCm39) E352G probably benign Het
Dmbt1 A G 7: 130,639,642 (GRCm39) D60G probably benign Het
Dock3 A G 9: 106,807,223 (GRCm39) L1368P probably damaging Het
Dytn A T 1: 63,686,611 (GRCm39) V353D probably benign Het
Egfem1 G A 3: 29,411,317 (GRCm39) E155K probably benign Het
Eif3m A T 2: 104,831,705 (GRCm39) M285K probably damaging Het
Fam135b T C 15: 71,335,856 (GRCm39) K446R probably benign Het
Fbxo22 T C 9: 55,116,442 (GRCm39) L36P probably damaging Het
Frmd4a T C 2: 4,612,844 (GRCm39) S1025P possibly damaging Het
Gja8 C T 3: 96,826,664 (GRCm39) V333M possibly damaging Het
Grid2ip G A 5: 143,359,194 (GRCm39) R270Q probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hspa4 T C 11: 53,171,466 (GRCm39) E246G probably benign Het
Ibtk A G 9: 85,585,702 (GRCm39) probably null Het
Ifit1 A G 19: 34,625,236 (GRCm39) E124G possibly damaging Het
Ifna14 T C 4: 88,489,752 (GRCm39) D95G probably benign Het
Igsf10 G A 3: 59,243,843 (GRCm39) R164W probably damaging Het
Ilkap A C 1: 91,314,937 (GRCm39) I142S probably benign Het
Insyn2a A T 7: 134,520,439 (GRCm39) Y30* probably null Het
Kctd14 C G 7: 97,104,104 (GRCm39) P53R unknown Het
Kndc1 A T 7: 139,500,600 (GRCm39) D655V probably damaging Het
Krt1c A C 15: 101,725,948 (GRCm39) S197A probably benign Het
Lpin1 A T 12: 16,588,483 (GRCm39) S902R unknown Het
Mapk13 T C 17: 28,994,532 (GRCm39) I141T probably damaging Het
Micall2 A G 5: 139,701,827 (GRCm39) V472A unknown Het
Mmp15 T C 8: 96,092,959 (GRCm39) F113L probably benign Het
Msantd5f6 C T 4: 73,319,685 (GRCm39) A264T probably benign Het
Msh2 T G 17: 88,026,717 (GRCm39) S738A probably benign Het
Muc20 T G 16: 32,613,584 (GRCm39) T598P probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Ncf1 A T 5: 134,250,718 (GRCm39) N367K probably benign Het
Nme8 T G 13: 19,874,384 (GRCm39) I139L probably benign Het
Odam T C 5: 88,034,457 (GRCm39) F46L probably benign Het
Or51a25 C A 7: 102,372,795 (GRCm39) V301F possibly damaging Het
Or7a42 G A 10: 78,791,929 (GRCm39) D297N possibly damaging Het
Pcare A G 17: 72,057,217 (GRCm39) L820P probably damaging Het
Pi4ka A G 16: 17,099,788 (GRCm39) I1945T Het
Rbmyf9 T G Y: 3,774,819 (GRCm39) D5E probably damaging Het
Rell1 T C 5: 64,097,105 (GRCm39) probably benign Het
Ripk3 A G 14: 56,023,303 (GRCm39) F134S probably benign Het
Sclt1 A T 3: 41,665,631 (GRCm39) W146R probably benign Het
Slc18a2 T C 19: 59,261,647 (GRCm39) M178T probably benign Het
Slc24a5 G T 2: 124,922,568 (GRCm39) G110V probably damaging Het
Slc38a10 T A 11: 119,996,781 (GRCm39) D772V probably benign Het
Slc9c1 T C 16: 45,398,275 (GRCm39) L680P possibly damaging Het
Tll2 T A 19: 41,093,436 (GRCm39) Y477F probably benign Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnrc18 G T 5: 142,773,392 (GRCm39) A479D Het
Topaz1 T A 9: 122,596,097 (GRCm39) M956K probably benign Het
Vmn2r56 T A 7: 12,444,237 (GRCm39) D465V possibly damaging Het
Xndc1 T A 7: 101,722,476 (GRCm39) V47E probably damaging Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107,484,758 (GRCm39) missense probably benign 0.01
IGL02450:Glis1 APN 4 107,484,726 (GRCm39) missense probably benign 0.25
IGL03167:Glis1 APN 4 107,293,102 (GRCm39) missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107,472,248 (GRCm39) missense probably damaging 1.00
IGL03377:Glis1 APN 4 107,489,478 (GRCm39) missense probably damaging 0.98
glenys UTSW 4 107,484,740 (GRCm39) missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107,425,316 (GRCm39) splice site probably null
R0981:Glis1 UTSW 4 107,472,239 (GRCm39) missense probably damaging 1.00
R1036:Glis1 UTSW 4 107,489,461 (GRCm39) missense probably benign 0.05
R1527:Glis1 UTSW 4 107,425,123 (GRCm39) missense probably damaging 0.96
R1741:Glis1 UTSW 4 107,425,544 (GRCm39) missense probably damaging 1.00
R2937:Glis1 UTSW 4 107,489,488 (GRCm39) missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107,489,488 (GRCm39) missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107,425,042 (GRCm39) missense probably benign 0.01
R4412:Glis1 UTSW 4 107,491,915 (GRCm39) missense probably damaging 0.99
R4587:Glis1 UTSW 4 107,484,740 (GRCm39) missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107,424,842 (GRCm39) missense probably benign 0.00
R4900:Glis1 UTSW 4 107,476,761 (GRCm39) missense probably damaging 1.00
R5138:Glis1 UTSW 4 107,480,302 (GRCm39) frame shift probably null
R5167:Glis1 UTSW 4 107,491,891 (GRCm39) missense probably damaging 1.00
R5511:Glis1 UTSW 4 107,293,074 (GRCm39) missense probably damaging 0.99
R5568:Glis1 UTSW 4 107,476,832 (GRCm39) missense probably damaging 0.99
R5807:Glis1 UTSW 4 107,425,279 (GRCm39) missense probably benign 0.00
R6006:Glis1 UTSW 4 107,425,103 (GRCm39) missense probably damaging 1.00
R6180:Glis1 UTSW 4 107,484,710 (GRCm39) missense probably benign 0.06
R6219:Glis1 UTSW 4 107,489,102 (GRCm39) missense probably benign 0.27
R6856:Glis1 UTSW 4 107,293,076 (GRCm39) missense probably damaging 0.96
R7278:Glis1 UTSW 4 107,292,880 (GRCm39) start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107,491,900 (GRCm39) missense probably damaging 1.00
R7937:Glis1 UTSW 4 107,484,723 (GRCm39) missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107,489,572 (GRCm39) missense probably damaging 0.99
R7940:Glis1 UTSW 4 107,489,571 (GRCm39) missense probably damaging 1.00
R7954:Glis1 UTSW 4 107,476,854 (GRCm39) missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107,425,099 (GRCm39) missense probably damaging 1.00
R8931:Glis1 UTSW 4 107,421,060 (GRCm39) missense probably benign 0.35
R9227:Glis1 UTSW 4 107,425,327 (GRCm39) missense probably benign 0.45
R9767:Glis1 UTSW 4 107,491,794 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATATCAATCCTGTCATCCACTC -3'
(R):5'- AGAAGCAGGTGAAGTCTTCGC -3'

Sequencing Primer
(F):5'- CCTCCCAGACAGCTCTAGTTAG -3'
(R):5'- GTGAAGTCTTCGCCCTTGC -3'
Posted On 2022-02-07