Incidental Mutation 'R9230:Kndc1'
ID 700174
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9230 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139920684 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 655 (D655V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: D655V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: D655V

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151421
AA Change: D655V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116435
Gene: ENSMUSG00000066129
AA Change: D655V

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156941
Meta Mutation Damage Score 0.1215 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 (GRCm38) F274I probably damaging Het
Aen T A 7: 78,902,359 (GRCm38) D22E probably damaging Het
Appl1 T C 14: 26,923,735 (GRCm38) E706G unknown Het
Arhgap21 T C 2: 20,855,658 (GRCm38) T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 (GRCm38) Y511C probably damaging Het
Bsn T C 9: 108,112,260 (GRCm38) T2098A probably damaging Het
Cacna1h T C 17: 25,380,882 (GRCm38) Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 (GRCm38) I563T probably benign Het
Cblif G A 19: 11,760,384 (GRCm38) W386* probably null Het
Cd180 TA TAA 13: 102,705,006 (GRCm38) probably null Het
Cd55b A T 1: 130,422,882 (GRCm38) L26* probably null Het
Cdc42bpa A G 1: 180,106,073 (GRCm38) N759S probably benign Het
Chrm3 C A 13: 9,878,443 (GRCm38) V186L probably benign Het
Clrn2 A G 5: 45,463,941 (GRCm38) T226A probably damaging Het
Col3a1 C T 1: 45,343,978 (GRCm38) P1071S unknown Het
Csgalnact2 A G 6: 118,126,251 (GRCm38) L250P probably damaging Het
Cyp4a31 G T 4: 115,571,084 (GRCm38) E326* probably null Het
Def8 A G 8: 123,459,578 (GRCm38) E352G probably benign Het
Dmbt1 A G 7: 131,037,912 (GRCm38) D60G probably benign Het
Dock3 A G 9: 106,930,024 (GRCm38) L1368P probably damaging Het
Dytn A T 1: 63,647,452 (GRCm38) V353D probably benign Het
Egfem1 G A 3: 29,357,168 (GRCm38) E155K probably benign Het
Eif3m A T 2: 105,001,360 (GRCm38) M285K probably damaging Het
Fam135b T C 15: 71,464,007 (GRCm38) K446R probably benign Het
Fbxo22 T C 9: 55,209,158 (GRCm38) L36P probably damaging Het
Frmd4a T C 2: 4,608,033 (GRCm38) S1025P possibly damaging Het
Gja8 C T 3: 96,919,348 (GRCm38) V333M possibly damaging Het
Glis1 T C 4: 107,568,130 (GRCm38) S313P probably benign Het
Grid2ip G A 5: 143,373,439 (GRCm38) R270Q probably damaging Het
Hps4 G A 5: 112,378,039 (GRCm38) S642N possibly damaging Het
Hspa4 T C 11: 53,280,639 (GRCm38) E246G probably benign Het
Ibtk A G 9: 85,703,649 (GRCm38) probably null Het
Ifit1 A G 19: 34,647,836 (GRCm38) E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 (GRCm38) D95G probably benign Het
Igsf10 G A 3: 59,336,422 (GRCm38) R164W probably damaging Het
Ilkap A C 1: 91,387,215 (GRCm38) I142S probably benign Het
Insyn2a A T 7: 134,918,710 (GRCm38) Y30* probably null Het
Kctd14 C G 7: 97,454,897 (GRCm38) P53R unknown Het
Krt2 A C 15: 101,817,513 (GRCm38) S197A probably benign Het
Lpin1 A T 12: 16,538,482 (GRCm38) S902R unknown Het
Mapk13 T C 17: 28,775,558 (GRCm38) I141T probably damaging Het
Micall2 A G 5: 139,716,072 (GRCm38) V472A unknown Het
Mmp15 T C 8: 95,366,331 (GRCm38) F113L probably benign Het
Msantd5f6 C T 4: 73,401,448 (GRCm38) A264T probably benign Het
Msh2 T G 17: 87,719,289 (GRCm38) S738A probably benign Het
Muc20 T G 16: 32,793,214 (GRCm38) T598P probably damaging Het
Myo1f T C 17: 33,576,450 (GRCm38) V53A probably damaging Het
Ncf1 A T 5: 134,221,864 (GRCm38) N367K probably benign Het
Nme8 T G 13: 19,690,214 (GRCm38) I139L probably benign Het
Odam T C 5: 87,886,598 (GRCm38) F46L probably benign Het
Or51a25 C A 7: 102,723,588 (GRCm38) V301F possibly damaging Het
Or7a42 G A 10: 78,956,095 (GRCm38) D297N possibly damaging Het
Pcare A G 17: 71,750,222 (GRCm38) L820P probably damaging Het
Pi4ka A G 16: 17,281,924 (GRCm38) I1945T Het
Rbmyf9 T G Y: 3,774,819 (GRCm38) D5E probably damaging Het
Rell1 T C 5: 63,939,762 (GRCm38) probably benign Het
Ripk3 A G 14: 55,785,846 (GRCm38) F134S probably benign Het
Sclt1 A T 3: 41,711,196 (GRCm38) W146R probably benign Het
Slc18a2 T C 19: 59,273,215 (GRCm38) M178T probably benign Het
Slc24a5 G T 2: 125,080,648 (GRCm38) G110V probably damaging Het
Slc38a10 T A 11: 120,105,955 (GRCm38) D772V probably benign Het
Slc9c1 T C 16: 45,577,912 (GRCm38) L680P possibly damaging Het
Tll2 T A 19: 41,104,997 (GRCm38) Y477F probably benign Het
Tmco1 C T 1: 167,308,563 (GRCm38) probably benign Het
Tnrc18 G T 5: 142,787,637 (GRCm38) A479D Het
Topaz1 T A 9: 122,767,032 (GRCm38) M956K probably benign Het
Vmn2r56 T A 7: 12,710,310 (GRCm38) D465V possibly damaging Het
Xndc1 T A 7: 102,073,269 (GRCm38) V47E probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,901,988 (GRCm38) splice site probably benign
IGL01061:Kndc1 APN 7 139,922,694 (GRCm38) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,920,784 (GRCm38) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,913,972 (GRCm38) splice site probably benign
IGL01767:Kndc1 APN 7 139,930,046 (GRCm38) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,914,194 (GRCm38) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,923,790 (GRCm38) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,920,767 (GRCm38) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,921,913 (GRCm38) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,910,901 (GRCm38) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,910,410 (GRCm38) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,901,181 (GRCm38) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,921,509 (GRCm38) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,920,689 (GRCm38) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,939,878 (GRCm38) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,923,776 (GRCm38) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,932,917 (GRCm38) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,910,304 (GRCm38) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,910,599 (GRCm38) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,930,124 (GRCm38) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,908,996 (GRCm38) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,914,023 (GRCm38) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,901,237 (GRCm38) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,923,735 (GRCm38) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,922,684 (GRCm38) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,927,408 (GRCm38) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,930,756 (GRCm38) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,927,711 (GRCm38) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,921,280 (GRCm38) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,930,761 (GRCm38) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,921,234 (GRCm38) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,930,112 (GRCm38) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,921,822 (GRCm38) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,901,207 (GRCm38) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,902,060 (GRCm38) splice site probably benign
R3747:Kndc1 UTSW 7 139,927,904 (GRCm38) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,908,977 (GRCm38) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,930,028 (GRCm38) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,924,129 (GRCm38) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,924,129 (GRCm38) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,937,025 (GRCm38) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,910,882 (GRCm38) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,920,684 (GRCm38) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,910,286 (GRCm38) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,921,427 (GRCm38) nonsense probably null
R4584:Kndc1 UTSW 7 139,901,243 (GRCm38) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,921,779 (GRCm38) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,930,123 (GRCm38) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,924,031 (GRCm38) nonsense probably null
R4859:Kndc1 UTSW 7 139,921,905 (GRCm38) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,932,879 (GRCm38) nonsense probably null
R5037:Kndc1 UTSW 7 139,910,455 (GRCm38) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,936,809 (GRCm38) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,908,962 (GRCm38) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,931,889 (GRCm38) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,927,891 (GRCm38) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,924,111 (GRCm38) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,895,217 (GRCm38) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,936,879 (GRCm38) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,939,827 (GRCm38) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,927,420 (GRCm38) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,923,775 (GRCm38) frame shift probably null
R6076:Kndc1 UTSW 7 139,902,038 (GRCm38) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,923,802 (GRCm38) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,921,213 (GRCm38) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,921,063 (GRCm38) missense probably benign
R6367:Kndc1 UTSW 7 139,913,506 (GRCm38) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,922,751 (GRCm38) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,920,976 (GRCm38) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,913,569 (GRCm38) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,910,278 (GRCm38) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,921,828 (GRCm38) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,936,836 (GRCm38) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,931,860 (GRCm38) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,920,783 (GRCm38) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,909,043 (GRCm38) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,920,696 (GRCm38) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,923,775 (GRCm38) frame shift probably null
R7625:Kndc1 UTSW 7 139,938,017 (GRCm38) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,895,260 (GRCm38) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,939,838 (GRCm38) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,923,816 (GRCm38) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,920,964 (GRCm38) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,921,486 (GRCm38) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,910,620 (GRCm38) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,918,844 (GRCm38) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,901,369 (GRCm38) splice site probably null
R8197:Kndc1 UTSW 7 139,913,531 (GRCm38) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,924,045 (GRCm38) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,913,518 (GRCm38) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,913,518 (GRCm38) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,901,205 (GRCm38) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,923,753 (GRCm38) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,910,214 (GRCm38) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,937,996 (GRCm38) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,924,061 (GRCm38) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,927,795 (GRCm38) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,921,441 (GRCm38) missense possibly damaging 0.89
R9291:Kndc1 UTSW 7 139,895,224 (GRCm38) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,921,476 (GRCm38) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,930,118 (GRCm38) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,930,118 (GRCm38) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,939,914 (GRCm38) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,920,704 (GRCm38) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,921,912 (GRCm38) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,910,813 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGGCTAAGCTTGATGTAGAAC -3'
(R):5'- AAGGCAAGCTGGTCTCTGTG -3'

Sequencing Primer
(F):5'- GCTAAGCTTGATGTAGAACAGCCTC -3'
(R):5'- AACTCAGGAGGGGTCACC -3'
Posted On 2022-02-07