Incidental Mutation 'R9230:Olfr8'
ID 700184
Institutional Source Beutler Lab
Gene Symbol Olfr8
Ensembl Gene ENSMUSG00000094080
Gene Name olfactory receptor 8
Synonyms MOR139-5P, GA_x6K02T2QGN0-2857086-2856154
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock # R9230 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 78950636-78958378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78956095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 297 (D297N)
Ref Sequence ENSEMBL: ENSMUSP00000144916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
AlphaFold Q60892
Predicted Effect possibly damaging
Transcript: ENSMUST00000081571
AA Change: D297N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: D297N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203851
AA Change: D297N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: D297N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214952
AA Change: D297N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Aen T A 7: 78,902,359 D22E probably damaging Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
Bsn T C 9: 108,112,260 T2098A probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Csgalnact2 A G 6: 118,126,251 L250P probably damaging Het
Cyp4a31 G T 4: 115,571,084 E326* probably null Het
Def8 A G 8: 123,459,578 E352G probably benign Het
Dmbt1 A G 7: 131,037,912 D60G probably benign Het
Dock3 A G 9: 106,930,024 L1368P probably damaging Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam196a A T 7: 134,918,710 Y30* probably null Het
Fbxo22 T C 9: 55,209,158 L36P probably damaging Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Gja8 C T 3: 96,919,348 V333M possibly damaging Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm11487 C T 4: 73,401,448 A264T probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspa4 T C 11: 53,280,639 E246G probably benign Het
Ibtk A G 9: 85,703,649 probably null Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Kctd14 C G 7: 97,454,897 P53R unknown Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Krt2 A C 15: 101,817,513 S197A probably benign Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Muc20 T G 16: 32,793,214 T598P probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Olfr559 C A 7: 102,723,588 V301F possibly damaging Het
Pi4ka A G 16: 17,281,924 I1945T Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Slc18a2 T C 19: 59,273,215 M178T probably benign Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Slc9c1 T C 16: 45,577,912 L680P possibly damaging Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 G T 5: 142,787,637 A479D Het
Topaz1 T A 9: 122,767,032 M956K probably benign Het
Vmn2r56 T A 7: 12,710,310 D465V possibly damaging Het
Xndc1 T A 7: 102,073,269 V47E probably damaging Het
Other mutations in Olfr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr8 APN 10 78955354 missense possibly damaging 0.48
IGL01480:Olfr8 APN 10 78956144 utr 3 prime probably benign
IGL02505:Olfr8 APN 10 78955933 missense probably benign 0.02
IGL02543:Olfr8 APN 10 78955939 missense probably damaging 1.00
IGL03323:Olfr8 APN 10 78955600 missense probably benign
PIT4466001:Olfr8 UTSW 10 78955842 missense probably benign 0.00
R1496:Olfr8 UTSW 10 78955848 missense probably benign 0.41
R1754:Olfr8 UTSW 10 78955697 missense probably damaging 0.99
R1878:Olfr8 UTSW 10 78955805 missense possibly damaging 0.62
R2760:Olfr8 UTSW 10 78956042 missense probably damaging 0.99
R4202:Olfr8 UTSW 10 78955295 missense probably benign
R4206:Olfr8 UTSW 10 78955283 missense probably benign 0.00
R4517:Olfr8 UTSW 10 78956043 nonsense probably null
R4613:Olfr8 UTSW 10 78956065 missense probably damaging 1.00
R4799:Olfr8 UTSW 10 78956097 missense probably null 0.92
R4979:Olfr8 UTSW 10 78955932 nonsense probably null
R5008:Olfr8 UTSW 10 78956071 missense probably damaging 1.00
R5700:Olfr8 UTSW 10 78955484 missense probably damaging 1.00
R5876:Olfr8 UTSW 10 78955357 missense probably benign 0.15
R6439:Olfr8 UTSW 10 78955984 missense probably damaging 1.00
R6930:Olfr8 UTSW 10 78955781 missense possibly damaging 0.84
R7110:Olfr8 UTSW 10 78955450 missense possibly damaging 0.83
R7405:Olfr8 UTSW 10 78955697 missense probably benign 0.14
R7524:Olfr8 UTSW 10 78955491 nonsense probably null
R8198:Olfr8 UTSW 10 78955724 missense probably damaging 0.97
R9227:Olfr8 UTSW 10 78956095 missense possibly damaging 0.92
Z1176:Olfr8 UTSW 10 78955219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGGCATTTTCTACATGTGTC -3'
(R):5'- TGTGGGATATCATAGGCGCC -3'

Sequencing Primer
(F):5'- GGCATTTTCTACATGTGTCTCTCAC -3'
(R):5'- AAGGGTGATGCATCCCTTGAATC -3'
Posted On 2022-02-07