Incidental Mutation 'R0759:Trim35'
ID70019
Institutional Source Beutler Lab
Gene Symbol Trim35
Ensembl Gene ENSMUSG00000022043
Gene Nametripartite motif-containing 35
SynonymsHls5, Mair, A430106H13Rik, 0710005M05Rik
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0759 (G1)
Quality Score211
Status Not validated
Chromosome14
Chromosomal Location66297031-66311424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66308787 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 334 (D334E)
Ref Sequence ENSEMBL: ENSMUSP00000022623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022623]
Predicted Effect probably benign
Transcript: ENSMUST00000022623
AA Change: D334E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: D334E

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
RING 36 75 6.89e-8 SMART
BBOX 111 152 1.27e-6 SMART
coiled coil region 219 267 N/A INTRINSIC
PRY 316 367 4.41e-15 SMART
Pfam:SPRY 370 495 3.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121006
SMART Domains Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
RING 30 69 6.89e-8 SMART
BBOX 105 146 1.27e-6 SMART
coiled coil region 212 260 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Slurp1 A G 15: 74,726,959 F61S probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Trim35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Trim35 APN 14 66308801 missense probably damaging 1.00
IGL02398:Trim35 APN 14 66309248 missense probably damaging 1.00
IGL03132:Trim35 APN 14 66309146 missense probably damaging 1.00
R0799:Trim35 UTSW 14 66309201 missense probably damaging 1.00
R0848:Trim35 UTSW 14 66309125 missense probably benign 0.01
R1170:Trim35 UTSW 14 66308799 missense probably benign 0.35
R1734:Trim35 UTSW 14 66309329 missense probably damaging 0.99
R1751:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R1767:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R2259:Trim35 UTSW 14 66309262 nonsense probably null
R3963:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R4572:Trim35 UTSW 14 66307873 missense probably damaging 1.00
R5068:Trim35 UTSW 14 66308972 unclassified probably benign
R5069:Trim35 UTSW 14 66308972 unclassified probably benign
R5070:Trim35 UTSW 14 66308972 unclassified probably benign
R5372:Trim35 UTSW 14 66297266 missense possibly damaging 0.69
R5886:Trim35 UTSW 14 66304053 missense possibly damaging 0.92
R5886:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R6018:Trim35 UTSW 14 66308750 missense probably damaging 1.00
R6165:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R6326:Trim35 UTSW 14 66303204 missense possibly damaging 0.52
R6476:Trim35 UTSW 14 66308795 missense probably damaging 1.00
R7084:Trim35 UTSW 14 66308822 missense probably damaging 0.98
R7192:Trim35 UTSW 14 66297446 missense probably damaging 1.00
R7350:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R7546:Trim35 UTSW 14 66303247 missense probably benign 0.02
R7644:Trim35 UTSW 14 66297097 missense unknown
R7916:Trim35 UTSW 14 66308860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGGCATTTGCTGCATTGC -3'
(R):5'- GTACCAGAAGCCTGAGCGTGTATC -3'

Sequencing Primer
(F):5'- gggggtggaggtagtttgg -3'
(R):5'- CACCTACGTCAGCCTGAG -3'
Posted On2013-09-30