Incidental Mutation 'R9230:Krt2'
ID 700195
Institutional Source Beutler Lab
Gene Symbol Krt2
Ensembl Gene ENSMUSG00000064201
Gene Name keratin 2
Synonyms Krt2-17, Krt2-2, Krt2e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R9230 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101810689-101818169 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 101817513 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 197 (S197A)
Ref Sequence ENSEMBL: ENSMUSP00000023712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023712]
AlphaFold Q3TTY5
Predicted Effect probably benign
Transcript: ENSMUST00000023712
AA Change: S197A

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023712
Gene: ENSMUSG00000064201
AA Change: S197A

DomainStartEndE-ValueType
Pfam:Keratin_2_head 23 195 3.6e-26 PFAM
Filament 198 511 4.22e-152 SMART
low complexity region 520 533 N/A INTRINSIC
low complexity region 538 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (68/68)
MGI Phenotype PHENOTYPE: ENU-induced mutant mice exhibit scaly skin and increased pigmentation in the tail, ears and feet. Mice homozygous for a knock-out allele show scaly skin, acanthosis, hyperkeratosis, increased water loss, ear skin inflammation, and aberrant aggregation of keratin 10 in suprabasal epidermal keratinocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Aen T A 7: 78,902,359 D22E probably damaging Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
Bsn T C 9: 108,112,260 T2098A probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Csgalnact2 A G 6: 118,126,251 L250P probably damaging Het
Cyp4a31 G T 4: 115,571,084 E326* probably null Het
Def8 A G 8: 123,459,578 E352G probably benign Het
Dmbt1 A G 7: 131,037,912 D60G probably benign Het
Dock3 A G 9: 106,930,024 L1368P probably damaging Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam196a A T 7: 134,918,710 Y30* probably null Het
Fbxo22 T C 9: 55,209,158 L36P probably damaging Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Gja8 C T 3: 96,919,348 V333M possibly damaging Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm11487 C T 4: 73,401,448 A264T probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspa4 T C 11: 53,280,639 E246G probably benign Het
Ibtk A G 9: 85,703,649 probably null Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Kctd14 C G 7: 97,454,897 P53R unknown Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Muc20 T G 16: 32,793,214 T598P probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Olfr559 C A 7: 102,723,588 V301F possibly damaging Het
Olfr8 G A 10: 78,956,095 D297N possibly damaging Het
Pi4ka A G 16: 17,281,924 I1945T Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Slc18a2 T C 19: 59,273,215 M178T probably benign Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Slc9c1 T C 16: 45,577,912 L680P possibly damaging Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 G T 5: 142,787,637 A479D Het
Topaz1 T A 9: 122,767,032 M956K probably benign Het
Vmn2r56 T A 7: 12,710,310 D465V possibly damaging Het
Xndc1 T A 7: 102,073,269 V47E probably damaging Het
Other mutations in Krt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Krt2 APN 15 101811211 missense probably benign 0.23
IGL01568:Krt2 APN 15 101813211 missense probably damaging 1.00
IGL01586:Krt2 APN 15 101811390 missense unknown
IGL01667:Krt2 APN 15 101816330 missense possibly damaging 0.85
IGL02017:Krt2 APN 15 101816504 missense probably damaging 1.00
IGL02022:Krt2 APN 15 101816518 missense probably damaging 1.00
IGL02538:Krt2 APN 15 101811154 missense unknown
IGL02959:Krt2 APN 15 101811328 missense unknown
IGL03295:Krt2 APN 15 101816429 missense probably damaging 0.99
R0195:Krt2 UTSW 15 101813191 nonsense probably null
R0472:Krt2 UTSW 15 101813253 missense probably damaging 1.00
R0749:Krt2 UTSW 15 101817663 missense unknown
R0785:Krt2 UTSW 15 101817921 missense unknown
R0792:Krt2 UTSW 15 101816497 missense probably damaging 1.00
R1232:Krt2 UTSW 15 101811784 missense probably damaging 1.00
R1281:Krt2 UTSW 15 101813292 missense probably damaging 1.00
R1770:Krt2 UTSW 15 101811154 missense unknown
R1783:Krt2 UTSW 15 101813973 missense probably damaging 1.00
R1795:Krt2 UTSW 15 101816426 missense possibly damaging 0.85
R2283:Krt2 UTSW 15 101814387 missense probably damaging 1.00
R3977:Krt2 UTSW 15 101811127 missense unknown
R4575:Krt2 UTSW 15 101814486 missense probably damaging 1.00
R4619:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4620:Krt2 UTSW 15 101817591 missense probably damaging 1.00
R4766:Krt2 UTSW 15 101813960 missense probably damaging 1.00
R4819:Krt2 UTSW 15 101811544 missense unknown
R4953:Krt2 UTSW 15 101813942 missense probably damaging 1.00
R5108:Krt2 UTSW 15 101813286 missense possibly damaging 0.88
R5973:Krt2 UTSW 15 101816312 missense probably damaging 0.99
R6122:Krt2 UTSW 15 101815914 missense probably damaging 1.00
R6180:Krt2 UTSW 15 101815044 missense probably benign 0.05
R6661:Krt2 UTSW 15 101815963 missense probably damaging 1.00
R6974:Krt2 UTSW 15 101817879 missense unknown
R6993:Krt2 UTSW 15 101815960 missense probably damaging 1.00
R7104:Krt2 UTSW 15 101815087 missense probably benign 0.09
R7573:Krt2 UTSW 15 101814519 missense probably benign 0.05
R7947:Krt2 UTSW 15 101816334 missense probably damaging 1.00
R8469:Krt2 UTSW 15 101816369 missense probably benign 0.22
R8805:Krt2 UTSW 15 101815944 missense possibly damaging 0.93
R9051:Krt2 UTSW 15 101817882 missense unknown
R9118:Krt2 UTSW 15 101814541 missense probably damaging 0.99
R9257:Krt2 UTSW 15 101816491 missense probably benign 0.05
R9424:Krt2 UTSW 15 101811357 missense unknown
R9569:Krt2 UTSW 15 101816489 missense probably damaging 1.00
R9576:Krt2 UTSW 15 101811357 missense unknown
RF020:Krt2 UTSW 15 101817968 missense unknown
Z1177:Krt2 UTSW 15 101811550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGCCTCATCAATGACTC -3'
(R):5'- ATCTCTAGTAGCGTGGCTGG -3'

Sequencing Primer
(F):5'- CCTCATCAATGACTCTTGAGGGAG -3'
(R):5'- TGGCAACAGTGGTGGCTAC -3'
Posted On 2022-02-07