Incidental Mutation 'R9230:Pi4ka'
ID 700196
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Name phosphatidylinositol 4-kinase alpha
Synonyms Pik4ca
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9230 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17280351-17406314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17281924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1945 (I1945T)
Ref Sequence ENSEMBL: ENSMUSP00000036162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000164950] [ENSMUST00000232232] [ENSMUST00000232364]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: I1945T

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164950
SMART Domains Protein: ENSMUSP00000131127
Gene: ENSMUSG00000055692

DomainStartEndE-ValueType
coiled coil region 5 112 N/A INTRINSIC
Pfam:TMEM191C 182 302 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232167
Predicted Effect
Predicted Effect unknown
Transcript: ENSMUST00000232364
AA Change: N104S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Aen T A 7: 78,902,359 D22E probably damaging Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
Bsn T C 9: 108,112,260 T2098A probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Csgalnact2 A G 6: 118,126,251 L250P probably damaging Het
Cyp4a31 G T 4: 115,571,084 E326* probably null Het
Def8 A G 8: 123,459,578 E352G probably benign Het
Dmbt1 A G 7: 131,037,912 D60G probably benign Het
Dock3 A G 9: 106,930,024 L1368P probably damaging Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam196a A T 7: 134,918,710 Y30* probably null Het
Fbxo22 T C 9: 55,209,158 L36P probably damaging Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Gja8 C T 3: 96,919,348 V333M possibly damaging Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm11487 C T 4: 73,401,448 A264T probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspa4 T C 11: 53,280,639 E246G probably benign Het
Ibtk A G 9: 85,703,649 probably null Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Kctd14 C G 7: 97,454,897 P53R unknown Het
Kndc1 A T 7: 139,920,684 D655V probably damaging Het
Krt2 A C 15: 101,817,513 S197A probably benign Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Muc20 T G 16: 32,793,214 T598P probably damaging Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Olfr559 C A 7: 102,723,588 V301F possibly damaging Het
Olfr8 G A 10: 78,956,095 D297N possibly damaging Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Slc18a2 T C 19: 59,273,215 M178T probably benign Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Slc9c1 T C 16: 45,577,912 L680P possibly damaging Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 G T 5: 142,787,637 A479D Het
Topaz1 T A 9: 122,767,032 M956K probably benign Het
Vmn2r56 T A 7: 12,710,310 D465V possibly damaging Het
Xndc1 T A 7: 102,073,269 V47E probably damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
Pia UTSW 16 17281044 missense probably damaging 1.00
G1patch:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7622:Pi4ka UTSW 16 17293977 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
R8079:Pi4ka UTSW 16 17303060 missense
R8123:Pi4ka UTSW 16 17281092 missense
R8211:Pi4ka UTSW 16 17282905 missense
R8310:Pi4ka UTSW 16 17354048 critical splice donor site probably null
R8322:Pi4ka UTSW 16 17357573 missense
R8509:Pi4ka UTSW 16 17354144 missense
R8735:Pi4ka UTSW 16 17318370 missense
R8912:Pi4ka UTSW 16 17389366 missense
R8917:Pi4ka UTSW 16 17312446 missense
R8921:Pi4ka UTSW 16 17307740 missense
R8941:Pi4ka UTSW 16 17296943 unclassified probably benign
R9002:Pi4ka UTSW 16 17299453 missense
R9203:Pi4ka UTSW 16 17282301 missense
R9222:Pi4ka UTSW 16 17358361 missense
R9262:Pi4ka UTSW 16 17302995 missense
R9338:Pi4ka UTSW 16 17317363 missense
R9374:Pi4ka UTSW 16 17307710 missense
R9436:Pi4ka UTSW 16 17307806 missense
R9499:Pi4ka UTSW 16 17307710 missense
R9501:Pi4ka UTSW 16 17386292 missense
R9551:Pi4ka UTSW 16 17307710 missense
R9705:Pi4ka UTSW 16 17281951 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCACATGATCTGAGTGCTG -3'
(R):5'- CTTGGTAGAAGTGAGAGCTCTGC -3'

Sequencing Primer
(F):5'- GAACTCCTTTTCAGTGCCACTAAG -3'
(R):5'- AGCTCTGCTCTAACTTGACAC -3'
Posted On 2022-02-07