Incidental Mutation 'R9230:Slc9c1'
ID 700198
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R9230 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45398275 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 680 (L680P)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect possibly damaging
Transcript: ENSMUST00000159945
AA Change: L680P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: L680P

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162151
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,157,626 (GRCm39) F274I probably damaging Het
Aen T A 7: 78,552,107 (GRCm39) D22E probably damaging Het
Appl1 T C 14: 26,645,692 (GRCm39) E706G unknown Het
Arhgap21 T C 2: 20,860,469 (GRCm39) T1313A possibly damaging Het
Armc2 T C 10: 41,823,935 (GRCm39) Y511C probably damaging Het
Bsn T C 9: 107,989,459 (GRCm39) T2098A probably damaging Het
Cacna1h T C 17: 25,599,856 (GRCm39) Y1659C probably damaging Het
Catsperb T C 12: 101,516,053 (GRCm39) I563T probably benign Het
Cblif G A 19: 11,737,748 (GRCm39) W386* probably null Het
Cd180 TA TAA 13: 102,841,514 (GRCm39) probably null Het
Cd55b A T 1: 130,350,619 (GRCm39) L26* probably null Het
Cdc42bpa A G 1: 179,933,638 (GRCm39) N759S probably benign Het
Chrm3 C A 13: 9,928,479 (GRCm39) V186L probably benign Het
Clrn2 A G 5: 45,621,283 (GRCm39) T226A probably damaging Het
Col3a1 C T 1: 45,383,138 (GRCm39) P1071S unknown Het
Csgalnact2 A G 6: 118,103,212 (GRCm39) L250P probably damaging Het
Cyp4a31 G T 4: 115,428,281 (GRCm39) E326* probably null Het
Def8 A G 8: 124,186,317 (GRCm39) E352G probably benign Het
Dmbt1 A G 7: 130,639,642 (GRCm39) D60G probably benign Het
Dock3 A G 9: 106,807,223 (GRCm39) L1368P probably damaging Het
Dytn A T 1: 63,686,611 (GRCm39) V353D probably benign Het
Egfem1 G A 3: 29,411,317 (GRCm39) E155K probably benign Het
Eif3m A T 2: 104,831,705 (GRCm39) M285K probably damaging Het
Fam135b T C 15: 71,335,856 (GRCm39) K446R probably benign Het
Fbxo22 T C 9: 55,116,442 (GRCm39) L36P probably damaging Het
Frmd4a T C 2: 4,612,844 (GRCm39) S1025P possibly damaging Het
Gja8 C T 3: 96,826,664 (GRCm39) V333M possibly damaging Het
Glis1 T C 4: 107,425,327 (GRCm39) S313P probably benign Het
Grid2ip G A 5: 143,359,194 (GRCm39) R270Q probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hspa4 T C 11: 53,171,466 (GRCm39) E246G probably benign Het
Ibtk A G 9: 85,585,702 (GRCm39) probably null Het
Ifit1 A G 19: 34,625,236 (GRCm39) E124G possibly damaging Het
Ifna14 T C 4: 88,489,752 (GRCm39) D95G probably benign Het
Igsf10 G A 3: 59,243,843 (GRCm39) R164W probably damaging Het
Ilkap A C 1: 91,314,937 (GRCm39) I142S probably benign Het
Insyn2a A T 7: 134,520,439 (GRCm39) Y30* probably null Het
Kctd14 C G 7: 97,104,104 (GRCm39) P53R unknown Het
Kndc1 A T 7: 139,500,600 (GRCm39) D655V probably damaging Het
Krt1c A C 15: 101,725,948 (GRCm39) S197A probably benign Het
Lpin1 A T 12: 16,588,483 (GRCm39) S902R unknown Het
Mapk13 T C 17: 28,994,532 (GRCm39) I141T probably damaging Het
Micall2 A G 5: 139,701,827 (GRCm39) V472A unknown Het
Mmp15 T C 8: 96,092,959 (GRCm39) F113L probably benign Het
Msantd5f6 C T 4: 73,319,685 (GRCm39) A264T probably benign Het
Msh2 T G 17: 88,026,717 (GRCm39) S738A probably benign Het
Muc20 T G 16: 32,613,584 (GRCm39) T598P probably damaging Het
Myo1f T C 17: 33,795,424 (GRCm39) V53A probably damaging Het
Ncf1 A T 5: 134,250,718 (GRCm39) N367K probably benign Het
Nme8 T G 13: 19,874,384 (GRCm39) I139L probably benign Het
Odam T C 5: 88,034,457 (GRCm39) F46L probably benign Het
Or51a25 C A 7: 102,372,795 (GRCm39) V301F possibly damaging Het
Or7a42 G A 10: 78,791,929 (GRCm39) D297N possibly damaging Het
Pcare A G 17: 72,057,217 (GRCm39) L820P probably damaging Het
Pi4ka A G 16: 17,099,788 (GRCm39) I1945T Het
Rbmyf9 T G Y: 3,774,819 (GRCm39) D5E probably damaging Het
Rell1 T C 5: 64,097,105 (GRCm39) probably benign Het
Ripk3 A G 14: 56,023,303 (GRCm39) F134S probably benign Het
Sclt1 A T 3: 41,665,631 (GRCm39) W146R probably benign Het
Slc18a2 T C 19: 59,261,647 (GRCm39) M178T probably benign Het
Slc24a5 G T 2: 124,922,568 (GRCm39) G110V probably damaging Het
Slc38a10 T A 11: 119,996,781 (GRCm39) D772V probably benign Het
Tll2 T A 19: 41,093,436 (GRCm39) Y477F probably benign Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnrc18 G T 5: 142,773,392 (GRCm39) A479D Het
Topaz1 T A 9: 122,596,097 (GRCm39) M956K probably benign Het
Vmn2r56 T A 7: 12,444,237 (GRCm39) D465V possibly damaging Het
Xndc1 T A 7: 101,722,476 (GRCm39) V47E probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCATGCCATAGAATAGTCTTCAC -3'
(R):5'- ATTTTCTACTGTCGCTCTCAATATCA -3'

Sequencing Primer
(F):5'- TGCCATAGAATAGTCTTCACAAATG -3'
(R):5'- AGTTGACTGTGAGCATCCAC -3'
Posted On 2022-02-07