Incidental Mutation 'R0759:Slurp1'
ID70021
Institutional Source Beutler Lab
Gene Symbol Slurp1
Ensembl Gene ENSMUSG00000022596
Gene Namesecreted Ly6/Plaur domain containing 1
SynonymsARS component B, 1110021N19Rik
MMRRC Submission 038939-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0759 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74724318-74728034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74726959 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 61 (F61S)
Ref Sequence ENSEMBL: ENSMUSP00000141013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023261] [ENSMUST00000070923] [ENSMUST00000190433]
Predicted Effect unknown
Transcript: ENSMUST00000023261
AA Change: S86P
SMART Domains Protein: ENSMUSP00000023261
Gene: ENSMUSG00000022596
AA Change: S86P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LU 23 109 6.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070923
SMART Domains Protein: ENSMUSP00000069692
Gene: ENSMUSG00000056665

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:4HBT_2 54 185 5.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190433
AA Change: F61S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141013
Gene: ENSMUSG00000022596
AA Change: F61S

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
LU 23 109 6.93e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop palmoplantar keratoderma, decreased body weight, and neuromuscular and metabolic phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,662,497 F504I possibly damaging Het
A430078G23Rik T G 8: 3,388,822 probably benign Het
Amdhd2 C A 17: 24,161,613 C119F probably benign Het
Bsph2 A T 7: 13,556,727 Y76N probably damaging Het
C1s1 T C 6: 124,531,437 N531S probably damaging Het
Ces1c G A 8: 93,130,864 Q30* probably null Het
Cltc A C 11: 86,737,082 I80S probably null Het
Colec11 A G 12: 28,594,731 S249P probably damaging Het
Cxcl16 C T 11: 70,459,128 C24Y probably damaging Het
Cyhr1 A G 15: 76,646,185 *312Q probably null Het
Dennd4c A G 4: 86,788,829 I348V probably damaging Het
Elavl1 C A 8: 4,289,815 D256Y probably damaging Het
Fubp1 TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGGCGGCGG 3: 152,210,637 probably benign Het
Gm43434 T G 14: 54,145,495 probably benign Het
Il1a T A 2: 129,304,687 D162V probably damaging Het
Map3k19 A G 1: 127,817,425 Y1227H possibly damaging Het
Myb C T 10: 21,145,028 V501I probably benign Het
Nav1 A G 1: 135,455,260 I1238T possibly damaging Het
Nr0b2 A T 4: 133,553,738 Q105L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pdilt A T 7: 119,489,484 Y431* probably null Het
Plg A G 17: 12,410,951 H624R probably damaging Het
Ppl A G 16: 5,089,777 S885P probably benign Het
Ptdss1 T C 13: 66,987,804 L375P probably damaging Het
Rrm1 A G 7: 102,457,561 D347G probably benign Het
Sbf1 A T 15: 89,304,716 V573E probably damaging Het
Slc9a1 T A 4: 133,416,403 I400N probably damaging Het
Smpd3 T C 8: 106,265,228 E231G probably benign Het
Sned1 C T 1: 93,272,564 T564M probably damaging Het
Tril G T 6: 53,818,027 R737S probably damaging Het
Trim35 T A 14: 66,308,787 D334E probably benign Het
Trp53i11 A G 2: 93,198,958 T101A possibly damaging Het
Usp9y T C Y: 1,299,097 N2514D probably damaging Het
Xpc A T 6: 91,498,142 Y634N probably damaging Het
Other mutations in Slurp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3919:Slurp1 UTSW 15 74726810 makesense probably null
R4031:Slurp1 UTSW 15 74727487 missense probably damaging 1.00
R4090:Slurp1 UTSW 15 74726875 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTCAGGTTCCCAGTGCCCAACAAG -3'
(R):5'- ACTCAGGACCAGGTAGTGTGGATG -3'

Sequencing Primer
(F):5'- TGCTCATAGATCCAGGCATGTAG -3'
(R):5'- TGGATGCTCCACAGAGGC -3'
Posted On2013-09-30