Incidental Mutation 'R9232:Zdbf2'
ID 700273
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 068986-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 63312424-63353735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63347168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1849 (F1849S)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: F1849S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: F1849S

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: F1849S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: F1849S

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 (GRCm39) S278T probably benign Het
Adgrf1 T C 17: 43,621,295 (GRCm39) Y511H probably benign Het
Atp5pd A G 11: 115,309,221 (GRCm39) F38S probably benign Het
Cdc6 T G 11: 98,801,201 (GRCm39) S151A probably benign Het
Ceacam12 T A 7: 17,803,341 (GRCm39) M249K probably benign Het
Cenpt T C 8: 106,571,793 (GRCm39) Q446R probably damaging Het
Cnnm1 T A 19: 43,480,325 (GRCm39) S883T probably benign Het
Cntn6 T C 6: 104,815,781 (GRCm39) W721R probably damaging Het
Defb43 A G 14: 63,255,281 (GRCm39) K38R probably damaging Het
Eif2a T C 3: 58,463,022 (GRCm39) S522P probably benign Het
Erap1 T G 13: 74,811,637 (GRCm39) S332R probably benign Het
Foxa3 C A 7: 18,748,790 (GRCm39) R112L probably damaging Het
Foxf1 T A 8: 121,811,715 (GRCm39) M193K possibly damaging Het
Gbp11 T C 5: 105,476,290 (GRCm39) Y273C possibly damaging Het
Gli2 T A 1: 118,764,021 (GRCm39) T1377S probably benign Het
Gm10271 T A 10: 116,808,479 (GRCm39) L12F probably damaging Het
Grm5 G A 7: 87,723,591 (GRCm39) G627D probably damaging Het
Gtf3c4 A G 2: 28,724,848 (GRCm39) S295P probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Igsf10 G A 3: 59,243,843 (GRCm39) R164W probably damaging Het
Iqch T A 9: 63,329,200 (GRCm39) M1045L probably benign Het
Kcnt2 T C 1: 140,411,931 (GRCm39) S455P possibly damaging Het
Kif26b G A 1: 178,742,511 (GRCm39) G869E probably damaging Het
Kit A G 5: 75,799,792 (GRCm39) N508S probably benign Het
Lgals8 C T 13: 12,469,777 (GRCm39) V61M probably damaging Het
Lztr1 T C 16: 17,339,343 (GRCm39) V392A possibly damaging Het
Mad1l1 T A 5: 140,091,296 (GRCm39) M524L probably benign Het
Mob3b T C 4: 34,986,101 (GRCm39) N146D probably benign Het
Muc16 T C 9: 18,567,336 (GRCm39) T1728A unknown Het
Nlgn2 T C 11: 69,718,855 (GRCm39) H278R probably damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Plce1 A G 19: 38,705,423 (GRCm39) M943V probably benign Het
Pramel25 T G 4: 143,520,263 (GRCm39) L169R probably benign Het
Proser2 A G 2: 6,106,015 (GRCm39) L183P probably benign Het
Prss36 T C 7: 127,543,988 (GRCm39) I128V probably benign Het
Rabggta C T 14: 55,956,745 (GRCm39) V320I probably benign Het
Sepsecs A G 5: 52,823,344 (GRCm39) V125A probably benign Het
Sik3 C T 9: 46,123,216 (GRCm39) P1005L probably benign Het
Slc22a20 A T 19: 6,023,009 (GRCm39) I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Tap1 T C 17: 34,412,277 (GRCm39) V494A probably benign Het
Tg A G 15: 66,570,310 (GRCm39) D1394G probably benign Het
Tgfbr3 T C 5: 107,290,361 (GRCm39) T315A possibly damaging Het
Tmc2 A G 2: 130,085,049 (GRCm39) T559A probably damaging Het
Tph1 A G 7: 46,311,529 (GRCm39) I71T probably benign Het
Trib3 A T 2: 152,184,962 (GRCm39) C96S probably damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Trim56 A G 5: 137,141,632 (GRCm39) V628A probably damaging Het
Ttc6 A G 12: 57,776,210 (GRCm39) Y1718C probably damaging Het
Tuft1 T C 3: 94,529,445 (GRCm39) Q244R probably benign Het
Unc13b A G 4: 43,240,321 (GRCm39) T793A probably benign Het
Vmn1r39 A G 6: 66,781,580 (GRCm39) I246T possibly damaging Het
Xpo1 T C 11: 23,232,646 (GRCm39) S389P probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63,345,673 (GRCm39) missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63,346,364 (GRCm39) missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63,342,197 (GRCm39) missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63,342,236 (GRCm39) missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63,347,233 (GRCm39) missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0148:Zdbf2 UTSW 1 63,343,165 (GRCm39) nonsense probably null
R0433:Zdbf2 UTSW 1 63,345,302 (GRCm39) missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63,344,449 (GRCm39) missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63,344,109 (GRCm39) missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63,344,882 (GRCm39) missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63,342,589 (GRCm39) missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63,342,161 (GRCm39) missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63,342,212 (GRCm39) missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63,342,786 (GRCm39) missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63,342,199 (GRCm39) missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63,342,747 (GRCm39) missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63,343,018 (GRCm39) missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63,343,493 (GRCm39) missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63,348,131 (GRCm39) missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63,343,408 (GRCm39) nonsense probably null
R1700:Zdbf2 UTSW 1 63,341,900 (GRCm39) missense unknown
R1720:Zdbf2 UTSW 1 63,342,436 (GRCm39) missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1854:Zdbf2 UTSW 1 63,344,701 (GRCm39) frame shift probably null
R1973:Zdbf2 UTSW 1 63,348,860 (GRCm39) missense unknown
R2336:Zdbf2 UTSW 1 63,342,623 (GRCm39) missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63,344,774 (GRCm39) missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63,342,224 (GRCm39) missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63,343,364 (GRCm39) missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63,346,636 (GRCm39) missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63,347,579 (GRCm39) missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63,347,830 (GRCm39) missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63,347,483 (GRCm39) missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63,348,940 (GRCm39) missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63,342,020 (GRCm39) missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63,347,951 (GRCm39) missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63,342,397 (GRCm39) missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63,347,973 (GRCm39) missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63,342,809 (GRCm39) missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63,348,232 (GRCm39) missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63,344,062 (GRCm39) missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63,343,570 (GRCm39) missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63,347,092 (GRCm39) missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63,344,836 (GRCm39) missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63,345,035 (GRCm39) missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63,345,685 (GRCm39) missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63,319,977 (GRCm39) start gained probably benign
R6245:Zdbf2 UTSW 1 63,343,592 (GRCm39) missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63,346,981 (GRCm39) missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63,342,480 (GRCm39) missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63,346,637 (GRCm39) missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63,344,679 (GRCm39) missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63,343,073 (GRCm39) missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63,343,667 (GRCm39) missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63,343,679 (GRCm39) missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63,347,687 (GRCm39) missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63,348,031 (GRCm39) missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63,329,925 (GRCm39) missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63,345,925 (GRCm39) missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63,346,563 (GRCm39) missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63,346,718 (GRCm39) missense probably benign
R7177:Zdbf2 UTSW 1 63,334,120 (GRCm39) missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63,345,664 (GRCm39) missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63,342,563 (GRCm39) missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63,343,198 (GRCm39) missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63,346,669 (GRCm39) missense probably benign
R7695:Zdbf2 UTSW 1 63,346,529 (GRCm39) missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63,344,530 (GRCm39) missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63,343,264 (GRCm39) missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
R7759:Zdbf2 UTSW 1 63,347,535 (GRCm39) missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63,342,583 (GRCm39) missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63,345,986 (GRCm39) missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63,343,330 (GRCm39) missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63,345,260 (GRCm39) missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63,345,572 (GRCm39) missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63,343,225 (GRCm39) missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63,345,142 (GRCm39) missense probably benign
R8306:Zdbf2 UTSW 1 63,343,234 (GRCm39) missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63,345,750 (GRCm39) missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63,342,073 (GRCm39) missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63,344,135 (GRCm39) missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63,345,166 (GRCm39) missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63,348,729 (GRCm39) small deletion probably benign
R8528:Zdbf2 UTSW 1 63,342,545 (GRCm39) missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63,347,272 (GRCm39) missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63,347,162 (GRCm39) missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63,346,296 (GRCm39) missense
R9072:Zdbf2 UTSW 1 63,344,923 (GRCm39) missense possibly damaging 0.83
R9257:Zdbf2 UTSW 1 63,345,400 (GRCm39) missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63,343,288 (GRCm39) missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63,344,784 (GRCm39) missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63,342,536 (GRCm39) missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63,342,635 (GRCm39) missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63,341,811 (GRCm39) missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63,344,510 (GRCm39) missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63,347,166 (GRCm39) nonsense probably null
X0057:Zdbf2 UTSW 1 63,344,549 (GRCm39) missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63,344,696 (GRCm39) missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63,343,404 (GRCm39) missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63,348,362 (GRCm39) missense unknown
Z1177:Zdbf2 UTSW 1 63,343,245 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGGGTAAGAAAGTGACTTTTGAC -3'
(R):5'- AAGCCCCTCTGCTAAGGAAC -3'

Sequencing Primer
(F):5'- GGTAAGAAAGTGACTTTTGACTTGAG -3'
(R):5'- CTGCTAAGGAACAAGACTGTTTACC -3'
Posted On 2022-02-07