Mutagenetix > Incidental Mutation

Incidental Mutation 'R9232:Kcnt2'

700275

Institutional Source

Beutler Lab

Gene Symbol

Kcnt2

Ensembl Gene

ENSMUSG00000052726

Gene Name

potassium channel, subfamily T, member 2

Synonyms

E330038N15Rik

MMRRC Submission

068986-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R9232 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

140246158-140612067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140484193 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 455 (S455P)

Ref Sequence

ENSEMBL: ENSMUSP00000113333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119786] [ENSMUST00000120709] [ENSMUST00000120796]

AlphaFold

D3Z649

Predicted Effect

probably benign
Transcript: ENSMUST00000119786
AA Change: S455P

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113535
Gene: ENSMUSG00000052726
AA Change: S455P

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.6e-15	PFAM
Pfam:BK_channel_a	422	476	2.3e-16	PFAM
low complexity region	598	613	N/A	INTRINSIC
low complexity region	620	632	N/A	INTRINSIC
low complexity region	699	714	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120709
AA Change: S455P

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112887
Gene: ENSMUSG00000052726
AA Change: S455P

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.7e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC
low complexity region	749	764	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120796
AA Change: S455P

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113333
Gene: ENSMUSG00000052726
AA Change: S455P

Domain	Start	End	E-Value	Type
transmembrane domain	64	83	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	138	160	N/A	INTRINSIC
Pfam:Ion_trans_2	199	282	2.8e-15	PFAM
Pfam:BK_channel_a	422	527	1.5e-39	PFAM
low complexity region	648	663	N/A	INTRINSIC
low complexity region	670	682	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele are viable with normal pain and itch responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	A	T	18: 10,652,198	S278T	probably benign	Het
Adgrf1	T	C	17: 43,310,404	Y511H	probably benign	Het
Atp5h	A	G	11: 115,418,395	F38S	probably benign	Het
Cdc6	T	G	11: 98,910,375	S151A	probably benign	Het
Ceacam12	T	A	7: 18,069,416	M249K	probably benign	Het
Cenpt	T	C	8: 105,845,161	Q446R	probably damaging	Het
Cnnm1	T	A	19: 43,491,886	S883T	probably benign	Het
Cntn6	T	C	6: 104,838,820	W721R	probably damaging	Het
Defb43	A	G	14: 63,017,832	K38R	probably damaging	Het
Eif2a	T	C	3: 58,555,601	S522P	probably benign	Het
Erap1	T	G	13: 74,663,518	S332R	probably benign	Het
Foxa3	C	A	7: 19,014,865	R112L	probably damaging	Het
Foxf1	T	A	8: 121,084,976	M193K	possibly damaging	Het
Gbp11	T	C	5: 105,328,424	Y273C	possibly damaging	Het
Gli2	T	A	1: 118,836,291	T1377S	probably benign	Het
Gm10271	T	A	10: 116,972,574	L12F	probably damaging	Het
Gm13023	T	G	4: 143,793,693	L169R	probably benign	Het
Grm5	G	A	7: 88,074,383	G627D	probably damaging	Het
Gtf3c4	A	G	2: 28,834,836	S295P	probably damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Igsf10	G	A	3: 59,336,422	R164W	probably damaging	Het
Iqch	T	A	9: 63,421,918	M1045L	probably benign	Het
Kif26b	G	A	1: 178,914,946	G869E	probably damaging	Het
Kit	A	G	5: 75,639,132	N508S	probably benign	Het
Lgals8	C	T	13: 12,454,896	V61M	probably damaging	Het
Lztr1	T	C	16: 17,521,479	V392A	possibly damaging	Het
Mad1l1	T	A	5: 140,105,541	M524L	probably benign	Het
Mob3b	T	C	4: 34,986,101	N146D	probably benign	Het
Muc16	T	C	9: 18,656,040	T1728A	unknown	Het
Nlgn2	T	C	11: 69,828,029	H278R	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Plce1	A	G	19: 38,716,979	M943V	probably benign	Het
Proser2	A	G	2: 6,101,204	L183P	probably benign	Het
Prss36	T	C	7: 127,944,816	I128V	probably benign	Het
Rabggta	C	T	14: 55,719,288	V320I	probably benign	Het
Sepsecs	A	G	5: 52,666,002	V125A	probably benign	Het
Sik3	C	T	9: 46,211,918	P1005L	probably benign	Het
Slc22a20	A	T	19: 5,972,981	I378N	possibly damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Tap1	T	C	17: 34,193,303	V494A	probably benign	Het
Tg	A	G	15: 66,698,461	D1394G	probably benign	Het
Tgfbr3	T	C	5: 107,142,495	T315A	possibly damaging	Het
Tmc2	A	G	2: 130,243,129	T559A	probably damaging	Het
Tph1	A	G	7: 46,662,105	I71T	probably benign	Het
Trib3	A	T	2: 152,343,042	C96S	probably damaging	Het
Trim28	G	A	7: 13,029,563	A544T	probably benign	Het
Trim56	A	G	5: 137,112,778	V628A	probably damaging	Het
Ttc6	A	G	12: 57,729,424	Y1718C	probably damaging	Het
Tuft1	T	C	3: 94,622,138	Q244R	probably benign	Het
Unc13b	A	G	4: 43,240,321	T793A	probably benign	Het
Vmn1r39	A	G	6: 66,804,596	I246T	possibly damaging	Het
Xpo1	T	C	11: 23,282,646	S389P	probably benign	Het
Zdbf2	T	C	1: 63,308,009	F1849S	possibly damaging	Het

Other mutations in Kcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Kcnt2	APN	1	140523098	missense	probably damaging	1.00
IGL00673:Kcnt2	APN	1	140596051	missense	possibly damaging	0.60
IGL00806:Kcnt2	APN	1	140523211	missense	probably damaging	1.00
IGL01135:Kcnt2	APN	1	140354555	critical splice donor site	probably null	0.00
IGL01412:Kcnt2	APN	1	140570417	missense	probably benign	0.02
IGL01777:Kcnt2	APN	1	140595998	missense	probably benign	0.20
IGL01780:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02134:Kcnt2	APN	1	140376383	missense	probably benign
IGL02350:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02357:Kcnt2	APN	1	140351269	missense	probably benign	0.09
IGL02481:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02483:Kcnt2	APN	1	140354561	splice site	probably benign
IGL02866:Kcnt2	APN	1	140425248	missense	probably damaging	1.00
IGL02891:Kcnt2	APN	1	140574806	missense	probably damaging	1.00
IGL03007:Kcnt2	APN	1	140354507	missense	possibly damaging	0.50
IGL03024:Kcnt2	APN	1	140570455	missense	probably benign	0.00
IGL03231:Kcnt2	APN	1	140534002	intron	probably benign
BB002:Kcnt2	UTSW	1	140354509	nonsense	probably null
BB012:Kcnt2	UTSW	1	140354509	nonsense	probably null
R0230:Kcnt2	UTSW	1	140246345	missense	probably benign	0.00
R0367:Kcnt2	UTSW	1	140351225	missense	probably damaging	1.00
R0486:Kcnt2	UTSW	1	140509480	nonsense	probably null
R0543:Kcnt2	UTSW	1	140609614	missense	probably damaging	1.00
R0849:Kcnt2	UTSW	1	140507762	missense	probably damaging	1.00
R1123:Kcnt2	UTSW	1	140573608	missense	probably damaging	1.00
R1156:Kcnt2	UTSW	1	140428855	missense	probably damaging	1.00
R1425:Kcnt2	UTSW	1	140383028	missense	probably damaging	1.00
R1530:Kcnt2	UTSW	1	140484232	nonsense	probably null
R1546:Kcnt2	UTSW	1	140431378	missense	probably benign	0.01
R1728:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1729:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1730:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1739:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1762:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1783:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1784:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1785:Kcnt2	UTSW	1	140354547	missense	probably benign	0.00
R1862:Kcnt2	UTSW	1	140425330	missense	probably damaging	1.00
R1887:Kcnt2	UTSW	1	140584247	missense	probably damaging	0.99
R1889:Kcnt2	UTSW	1	140584293	missense	probably damaging	1.00
R1894:Kcnt2	UTSW	1	140425341	missense	probably damaging	1.00
R2005:Kcnt2	UTSW	1	140553018	missense	probably damaging	0.98
R2044:Kcnt2	UTSW	1	140375154	missense	probably benign	0.14
R2115:Kcnt2	UTSW	1	140552963	missense	probably damaging	1.00
R2135:Kcnt2	UTSW	1	140428813	missense	probably damaging	1.00
R2201:Kcnt2	UTSW	1	140509441	missense	probably damaging	1.00
R2212:Kcnt2	UTSW	1	140530800	missense	probably damaging	1.00
R2267:Kcnt2	UTSW	1	140573683	splice site	probably null
R2442:Kcnt2	UTSW	1	140376353	missense	possibly damaging	0.59
R3121:Kcnt2	UTSW	1	140428884	missense	probably damaging	0.97
R3176:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3276:Kcnt2	UTSW	1	140609639	missense	probably benign	0.16
R3704:Kcnt2	UTSW	1	140533968	missense	probably damaging	1.00
R3944:Kcnt2	UTSW	1	140584287	missense	probably damaging	1.00
R4164:Kcnt2	UTSW	1	140609630	missense	probably damaging	0.97
R4201:Kcnt2	UTSW	1	140425332	missense	probably damaging	0.98
R4501:Kcnt2	UTSW	1	140552980	missense	probably damaging	0.99
R4502:Kcnt2	UTSW	1	140507747	missense	probably damaging	0.99
R4632:Kcnt2	UTSW	1	140523148	missense	possibly damaging	0.90
R4758:Kcnt2	UTSW	1	140518897	missense	probably damaging	1.00
R4790:Kcnt2	UTSW	1	140354516	missense	probably damaging	0.99
R4892:Kcnt2	UTSW	1	140513025	nonsense	probably null
R4973:Kcnt2	UTSW	1	140609650	missense	probably damaging	1.00
R5154:Kcnt2	UTSW	1	140351256	missense	possibly damaging	0.94
R5296:Kcnt2	UTSW	1	140609615	missense	probably damaging	1.00
R5353:Kcnt2	UTSW	1	140426901	missense	probably damaging	1.00
R5605:Kcnt2	UTSW	1	140574743	missense	possibly damaging	0.59
R5806:Kcnt2	UTSW	1	140509496	missense	probably damaging	1.00
R5887:Kcnt2	UTSW	1	140425366	missense	probably damaging	1.00
R5917:Kcnt2	UTSW	1	140533928	missense	probably damaging	0.99
R5961:Kcnt2	UTSW	1	140507702	missense	possibly damaging	0.82
R6123:Kcnt2	UTSW	1	140362980	missense	probably damaging	1.00
R6225:Kcnt2	UTSW	1	140426923	nonsense	probably null
R6248:Kcnt2	UTSW	1	140509478	missense	probably damaging	1.00
R6351:Kcnt2	UTSW	1	140375112	missense	probably damaging	1.00
R6380:Kcnt2	UTSW	1	140509584	missense	probably damaging	1.00
R6532:Kcnt2	UTSW	1	140584106	missense	probably damaging	0.97
R6693:Kcnt2	UTSW	1	140351227	missense	probably benign	0.00
R6817:Kcnt2	UTSW	1	140246193	unclassified	probably benign
R6856:Kcnt2	UTSW	1	140596004	missense	probably damaging	1.00
R6944:Kcnt2	UTSW	1	140584065	missense	probably benign	0.00
R6971:Kcnt2	UTSW	1	140512908	missense	probably benign	0.01
R7052:Kcnt2	UTSW	1	140383047	missense	probably damaging	0.99
R7138:Kcnt2	UTSW	1	140596040	missense	possibly damaging	0.80
R7261:Kcnt2	UTSW	1	140354517	missense	possibly damaging	0.71
R7474:Kcnt2	UTSW	1	140570478	missense	possibly damaging	0.84
R7524:Kcnt2	UTSW	1	140584055	missense	probably damaging	0.99
R7541:Kcnt2	UTSW	1	140376384	missense	probably benign	0.09
R7558:Kcnt2	UTSW	1	140523190	missense	probably damaging	0.98
R7651:Kcnt2	UTSW	1	140570461	missense	probably benign	0.40
R7730:Kcnt2	UTSW	1	140518948	missense	probably benign	0.34
R7875:Kcnt2	UTSW	1	140573647	missense	probably damaging	1.00
R7883:Kcnt2	UTSW	1	140523150	missense	probably damaging	0.99
R7925:Kcnt2	UTSW	1	140354509	nonsense	probably null
R8040:Kcnt2	UTSW	1	140450217	missense	probably damaging	1.00
R8041:Kcnt2	UTSW	1	140609660	missense	probably benign
R8171:Kcnt2	UTSW	1	140509465	missense	probably benign	0.13
R8268:Kcnt2	UTSW	1	140523216	missense	probably damaging	0.99
R8905:Kcnt2	UTSW	1	140507729	missense	possibly damaging	0.65
R8927:Kcnt2	UTSW	1	140428797	splice site	probably null
R8988:Kcnt2	UTSW	1	140428849	missense	probably benign	0.38
R9020:Kcnt2	UTSW	1	140584311	missense	probably benign	0.23
R9109:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9167:Kcnt2	UTSW	1	140578462	missense	probably benign	0.11
R9297:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9298:Kcnt2	UTSW	1	140425297	missense	probably damaging	1.00
R9318:Kcnt2	UTSW	1	140425195	missense	probably damaging	0.99
R9404:Kcnt2	UTSW	1	140425369	missense	probably damaging	1.00
X0062:Kcnt2	UTSW	1	140512991	missense	possibly damaging	0.50
Z1088:Kcnt2	UTSW	1	140573646	missense	probably damaging	1.00
Z1088:Kcnt2	UTSW	1	140584158	nonsense	probably null
Z1176:Kcnt2	UTSW	1	140376361	missense	probably damaging	1.00
Z1177:Kcnt2	UTSW	1	140609648	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- TTTTGGGGATAGCAGGGAAC -3'
(R):5'- TTGGGCCTCTTAAGAAGTCCATATC -3'

Sequencing Primer
(F):5'- AAGTATGTTTTTACTGAGCCTTCTGC -3'
(R):5'- GTAGGCACATATCTAGTTGTA -3'

Posted On

2022-02-07