Incidental Mutation 'R9232:Gtf3c4'
ID 700278
Institutional Source Beutler Lab
Gene Symbol Gtf3c4
Ensembl Gene ENSMUSG00000035666
Gene Name general transcription factor IIIC, polypeptide 4
Synonyms KAT12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28822299-28840360 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28834836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 295 (S295P)
Ref Sequence ENSEMBL: ENSMUSP00000042265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037117] [ENSMUST00000171404]
AlphaFold Q8BMQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000037117
AA Change: S295P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042265
Gene: ENSMUSG00000035666
AA Change: S295P

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
Pfam:TFIIIC_delta 59 250 1.1e-45 PFAM
low complexity region 609 621 N/A INTRINSIC
Pfam:zf-TFIIIC 728 816 2.7e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171404
AA Change: S154P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132171
Gene: ENSMUSG00000035666
AA Change: S154P

DomainStartEndE-ValueType
Pfam:TFIIIC_delta 7 109 3.1e-17 PFAM
low complexity region 468 480 N/A INTRINSIC
Pfam:zf-TFIIIC 587 676 4.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Gtf3c4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Gtf3c4 APN 2 28833572 missense probably benign
IGL01419:Gtf3c4 APN 2 28835069 missense probably damaging 1.00
IGL01574:Gtf3c4 APN 2 28834436 missense possibly damaging 0.50
IGL01778:Gtf3c4 APN 2 28835088 missense probably damaging 1.00
IGL01802:Gtf3c4 APN 2 28834080 missense probably damaging 1.00
IGL02560:Gtf3c4 APN 2 28834267 nonsense probably null
R0190:Gtf3c4 UTSW 2 28840128 missense probably benign 0.19
R0245:Gtf3c4 UTSW 2 28834964 missense possibly damaging 0.71
R0440:Gtf3c4 UTSW 2 28840169 splice site probably null
R0882:Gtf3c4 UTSW 2 28834770 missense probably damaging 1.00
R1757:Gtf3c4 UTSW 2 28830636 splice site probably benign
R1809:Gtf3c4 UTSW 2 28833976 nonsense probably null
R1893:Gtf3c4 UTSW 2 28834362 missense possibly damaging 0.92
R1903:Gtf3c4 UTSW 2 28839956 missense probably benign 0.19
R2020:Gtf3c4 UTSW 2 28833894 missense possibly damaging 0.81
R2867:Gtf3c4 UTSW 2 28839904 utr 5 prime probably benign
R3076:Gtf3c4 UTSW 2 28835153 missense possibly damaging 0.56
R4113:Gtf3c4 UTSW 2 28827555 missense probably damaging 1.00
R4404:Gtf3c4 UTSW 2 28826749 missense probably damaging 1.00
R5751:Gtf3c4 UTSW 2 28827499 missense probably damaging 1.00
R5997:Gtf3c4 UTSW 2 28833711 missense possibly damaging 0.62
R8162:Gtf3c4 UTSW 2 28834581 nonsense probably null
R9164:Gtf3c4 UTSW 2 28834649 missense probably benign 0.31
R9170:Gtf3c4 UTSW 2 28840202 missense possibly damaging 0.86
R9308:Gtf3c4 UTSW 2 28834970 missense probably damaging 1.00
R9415:Gtf3c4 UTSW 2 28833954 missense possibly damaging 0.95
Z1177:Gtf3c4 UTSW 2 28835073 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTGTGCACAGGTAACTTG -3'
(R):5'- AGGAGACACAGTATGCAGACCC -3'

Sequencing Primer
(F):5'- CAGGCTGCCTTAAAGTAAAGTAGCC -3'
(R):5'- GTATGCAGACCCCAGTCAGAATG -3'
Posted On 2022-02-07