Incidental Mutation 'R9232:Gm13023'
ID 700286
Institutional Source Beutler Lab
Gene Symbol Gm13023
Ensembl Gene ENSMUSG00000066031
Gene Name predicted gene 13023
Synonyms MGC:91194
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 143789352-143795575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 143793693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 169 (L169R)
Ref Sequence ENSEMBL: ENSMUSP00000082232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085144] [ENSMUST00000105770] [ENSMUST00000149739]
AlphaFold A2A8N2
Predicted Effect probably benign
Transcript: ENSMUST00000085144
AA Change: L169R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000082232
Gene: ENSMUSG00000066031
AA Change: L169R

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 3e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105770
Predicted Effect probably benign
Transcript: ENSMUST00000149739
AA Change: L5R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Gm13023
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Gm13023 APN 4 143795274 missense probably benign 0.43
IGL01621:Gm13023 APN 4 143793932 missense probably benign
IGL01777:Gm13023 APN 4 143795118 missense possibly damaging 0.87
IGL02075:Gm13023 APN 4 143795032 missense probably benign 0.05
IGL02098:Gm13023 APN 4 143793678 critical splice donor site probably null
IGL02148:Gm13023 APN 4 143792734 missense probably benign 0.25
IGL02355:Gm13023 APN 4 143793010 missense probably damaging 1.00
IGL02362:Gm13023 APN 4 143793010 missense probably damaging 1.00
IGL02828:Gm13023 APN 4 143795125 missense possibly damaging 0.95
IGL03102:Gm13023 APN 4 143793546 missense possibly damaging 0.84
IGL03234:Gm13023 APN 4 143794936 missense probably benign 0.33
BB004:Gm13023 UTSW 4 143792966 missense probably benign 0.29
BB014:Gm13023 UTSW 4 143792966 missense probably benign 0.29
K3955:Gm13023 UTSW 4 143795140 missense possibly damaging 0.79
R0054:Gm13023 UTSW 4 143795002 missense probably damaging 1.00
R0637:Gm13023 UTSW 4 143793909 missense probably benign 0.35
R1227:Gm13023 UTSW 4 143793564 missense probably benign 0.00
R1370:Gm13023 UTSW 4 143795304 missense possibly damaging 0.94
R1709:Gm13023 UTSW 4 143793546 missense possibly damaging 0.84
R1982:Gm13023 UTSW 4 143795150 missense probably benign 0.02
R2292:Gm13023 UTSW 4 143793876 missense probably benign 0.08
R3087:Gm13023 UTSW 4 143793846 missense probably benign 0.25
R4235:Gm13023 UTSW 4 143794774 missense probably damaging 0.97
R4454:Gm13023 UTSW 4 143792824 missense probably benign 0.00
R4504:Gm13023 UTSW 4 143793983 missense probably benign 0.08
R4937:Gm13023 UTSW 4 143793837 missense possibly damaging 0.46
R5041:Gm13023 UTSW 4 143793690 missense probably benign 0.01
R5379:Gm13023 UTSW 4 143794923 missense probably benign 0.00
R5399:Gm13023 UTSW 4 143795032 missense probably benign 0.00
R5445:Gm13023 UTSW 4 143795137 missense possibly damaging 0.50
R6059:Gm13023 UTSW 4 143793980 missense possibly damaging 0.80
R6885:Gm13023 UTSW 4 143793533 missense probably damaging 1.00
R7846:Gm13023 UTSW 4 143793993 missense probably benign 0.02
R7927:Gm13023 UTSW 4 143792966 missense probably benign 0.29
R8285:Gm13023 UTSW 4 143794066 missense probably benign 0.02
R8840:Gm13023 UTSW 4 143795068 missense probably damaging 1.00
R8849:Gm13023 UTSW 4 143795026 missense probably damaging 0.99
R8921:Gm13023 UTSW 4 143792752 nonsense probably null
R9128:Gm13023 UTSW 4 143793608 missense probably benign 0.00
Z1177:Gm13023 UTSW 4 143794981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGGTTTAATTCTAGGCAAAGG -3'
(R):5'- GCTCCTGTATACAGTCTGCG -3'

Sequencing Primer
(F):5'- GAATCAGAGTGTAAGATGTGTCTTC -3'
(R):5'- CCTGTATACAGTCTGCGTGTACAG -3'
Posted On 2022-02-07