Incidental Mutation 'R9232:Kit'
ID 700288
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene Name KIT proto-oncogene receptor tyrosine kinase
Synonyms Gsfsco1, CD117, SCO1, Gsfsow3, belly-spot, SCO5, SOW3, Tr-kit, c-KIT, Steel Factor Receptor, Gsfsco5, Dominant white spotting
MMRRC Submission 068986-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 75735647-75817382 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75799792 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 508 (N508S)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
AlphaFold P05532
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: N508S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: N508S

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: N508S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: N508S

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 (GRCm39) S278T probably benign Het
Adgrf1 T C 17: 43,621,295 (GRCm39) Y511H probably benign Het
Atp5pd A G 11: 115,309,221 (GRCm39) F38S probably benign Het
Cdc6 T G 11: 98,801,201 (GRCm39) S151A probably benign Het
Ceacam12 T A 7: 17,803,341 (GRCm39) M249K probably benign Het
Cenpt T C 8: 106,571,793 (GRCm39) Q446R probably damaging Het
Cnnm1 T A 19: 43,480,325 (GRCm39) S883T probably benign Het
Cntn6 T C 6: 104,815,781 (GRCm39) W721R probably damaging Het
Defb43 A G 14: 63,255,281 (GRCm39) K38R probably damaging Het
Eif2a T C 3: 58,463,022 (GRCm39) S522P probably benign Het
Erap1 T G 13: 74,811,637 (GRCm39) S332R probably benign Het
Foxa3 C A 7: 18,748,790 (GRCm39) R112L probably damaging Het
Foxf1 T A 8: 121,811,715 (GRCm39) M193K possibly damaging Het
Gbp11 T C 5: 105,476,290 (GRCm39) Y273C possibly damaging Het
Gli2 T A 1: 118,764,021 (GRCm39) T1377S probably benign Het
Gm10271 T A 10: 116,808,479 (GRCm39) L12F probably damaging Het
Grm5 G A 7: 87,723,591 (GRCm39) G627D probably damaging Het
Gtf3c4 A G 2: 28,724,848 (GRCm39) S295P probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Igsf10 G A 3: 59,243,843 (GRCm39) R164W probably damaging Het
Iqch T A 9: 63,329,200 (GRCm39) M1045L probably benign Het
Kcnt2 T C 1: 140,411,931 (GRCm39) S455P possibly damaging Het
Kif26b G A 1: 178,742,511 (GRCm39) G869E probably damaging Het
Lgals8 C T 13: 12,469,777 (GRCm39) V61M probably damaging Het
Lztr1 T C 16: 17,339,343 (GRCm39) V392A possibly damaging Het
Mad1l1 T A 5: 140,091,296 (GRCm39) M524L probably benign Het
Mob3b T C 4: 34,986,101 (GRCm39) N146D probably benign Het
Muc16 T C 9: 18,567,336 (GRCm39) T1728A unknown Het
Nlgn2 T C 11: 69,718,855 (GRCm39) H278R probably damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Plce1 A G 19: 38,705,423 (GRCm39) M943V probably benign Het
Pramel25 T G 4: 143,520,263 (GRCm39) L169R probably benign Het
Proser2 A G 2: 6,106,015 (GRCm39) L183P probably benign Het
Prss36 T C 7: 127,543,988 (GRCm39) I128V probably benign Het
Rabggta C T 14: 55,956,745 (GRCm39) V320I probably benign Het
Sepsecs A G 5: 52,823,344 (GRCm39) V125A probably benign Het
Sik3 C T 9: 46,123,216 (GRCm39) P1005L probably benign Het
Slc22a20 A T 19: 6,023,009 (GRCm39) I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Tap1 T C 17: 34,412,277 (GRCm39) V494A probably benign Het
Tg A G 15: 66,570,310 (GRCm39) D1394G probably benign Het
Tgfbr3 T C 5: 107,290,361 (GRCm39) T315A possibly damaging Het
Tmc2 A G 2: 130,085,049 (GRCm39) T559A probably damaging Het
Tph1 A G 7: 46,311,529 (GRCm39) I71T probably benign Het
Trib3 A T 2: 152,184,962 (GRCm39) C96S probably damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Trim56 A G 5: 137,141,632 (GRCm39) V628A probably damaging Het
Ttc6 A G 12: 57,776,210 (GRCm39) Y1718C probably damaging Het
Tuft1 T C 3: 94,529,445 (GRCm39) Q244R probably benign Het
Unc13b A G 4: 43,240,321 (GRCm39) T793A probably benign Het
Vmn1r39 A G 6: 66,781,580 (GRCm39) I246T possibly damaging Het
Xpo1 T C 11: 23,232,646 (GRCm39) S389P probably benign Het
Zdbf2 T C 1: 63,347,168 (GRCm39) F1849S possibly damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75,771,479 (GRCm39) missense probably benign 0.00
IGL00834:Kit APN 5 75,806,619 (GRCm39) missense probably damaging 1.00
IGL00846:Kit APN 5 75,801,471 (GRCm39) missense probably damaging 0.98
IGL01149:Kit APN 5 75,771,536 (GRCm39) missense probably damaging 0.97
IGL01341:Kit APN 5 75,767,734 (GRCm39) missense probably damaging 1.00
IGL02004:Kit APN 5 75,781,674 (GRCm39) missense probably benign
IGL02281:Kit APN 5 75,815,194 (GRCm39) missense possibly damaging 0.66
IGL02424:Kit APN 5 75,799,766 (GRCm39) missense probably benign
IGL02697:Kit APN 5 75,767,919 (GRCm39) missense probably benign
IGL02929:Kit APN 5 75,801,429 (GRCm39) missense probably damaging 1.00
IGL03053:Kit APN 5 75,771,574 (GRCm39) missense probably benign
IGL03127:Kit APN 5 75,801,848 (GRCm39) missense probably benign 0.44
IGL03174:Kit APN 5 75,767,773 (GRCm39) missense probably benign
IGL03381:Kit APN 5 75,767,788 (GRCm39) missense probably benign 0.04
casper UTSW 5 75,806,535 (GRCm39) missense probably damaging 1.00
Mooyah2 UTSW 5 75,813,468 (GRCm39) missense probably damaging 1.00
pretty2 UTSW 5 75,810,210 (GRCm39) missense probably damaging 1.00
slimmer UTSW 5 75,801,417 (GRCm39) missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75,799,668 (GRCm39) missense probably benign 0.00
R0022:Kit UTSW 5 75,783,657 (GRCm39) missense probably benign 0.00
R0022:Kit UTSW 5 75,783,657 (GRCm39) missense probably benign 0.00
R0092:Kit UTSW 5 75,808,414 (GRCm39) missense possibly damaging 0.93
R0254:Kit UTSW 5 75,781,581 (GRCm39) missense probably benign
R0329:Kit UTSW 5 75,813,489 (GRCm39) missense probably damaging 1.00
R0609:Kit UTSW 5 75,771,539 (GRCm39) missense probably benign 0.35
R1068:Kit UTSW 5 75,770,178 (GRCm39) missense probably benign
R1115:Kit UTSW 5 75,810,192 (GRCm39) splice site probably benign
R1480:Kit UTSW 5 75,797,977 (GRCm39) missense probably benign 0.00
R1639:Kit UTSW 5 75,813,467 (GRCm39) missense probably damaging 1.00
R1801:Kit UTSW 5 75,809,053 (GRCm39) missense probably damaging 1.00
R1973:Kit UTSW 5 75,776,102 (GRCm39) missense probably damaging 1.00
R2033:Kit UTSW 5 75,797,977 (GRCm39) missense possibly damaging 0.88
R3125:Kit UTSW 5 75,808,488 (GRCm39) missense probably null 0.00
R3125:Kit UTSW 5 75,808,487 (GRCm39) missense probably benign 0.07
R3437:Kit UTSW 5 75,806,565 (GRCm39) missense probably damaging 1.00
R3791:Kit UTSW 5 75,799,810 (GRCm39) missense probably damaging 1.00
R3939:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R3940:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R3941:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R3942:Kit UTSW 5 75,769,978 (GRCm39) missense probably benign 0.00
R4092:Kit UTSW 5 75,771,470 (GRCm39) missense probably benign 0.28
R4376:Kit UTSW 5 75,801,159 (GRCm39) missense probably benign 0.00
R4377:Kit UTSW 5 75,801,159 (GRCm39) missense probably benign 0.00
R4668:Kit UTSW 5 75,801,880 (GRCm39) splice site probably null
R5104:Kit UTSW 5 75,776,138 (GRCm39) missense probably benign 0.00
R5152:Kit UTSW 5 75,781,507 (GRCm39) missense probably benign 0.00
R5154:Kit UTSW 5 75,801,200 (GRCm39) missense probably damaging 0.99
R5508:Kit UTSW 5 75,810,208 (GRCm39) missense probably damaging 1.00
R5624:Kit UTSW 5 75,770,054 (GRCm39) missense probably benign 0.40
R5731:Kit UTSW 5 75,815,075 (GRCm39) missense possibly damaging 0.93
R6270:Kit UTSW 5 75,770,169 (GRCm39) missense probably benign
R6565:Kit UTSW 5 75,806,513 (GRCm39) missense probably damaging 1.00
R6694:Kit UTSW 5 75,801,417 (GRCm39) missense possibly damaging 0.94
R6805:Kit UTSW 5 75,813,468 (GRCm39) missense probably damaging 1.00
R6823:Kit UTSW 5 75,813,309 (GRCm39) missense probably benign 0.01
R6848:Kit UTSW 5 75,767,872 (GRCm39) missense probably benign
R7021:Kit UTSW 5 75,781,627 (GRCm39) missense probably benign 0.00
R7080:Kit UTSW 5 75,767,941 (GRCm39) missense probably damaging 0.99
R7117:Kit UTSW 5 75,767,758 (GRCm39) missense probably benign 0.18
R7156:Kit UTSW 5 75,776,034 (GRCm39) missense probably benign 0.14
R7379:Kit UTSW 5 75,808,412 (GRCm39) missense probably damaging 1.00
R7427:Kit UTSW 5 75,806,507 (GRCm39) missense possibly damaging 0.92
R7438:Kit UTSW 5 75,799,660 (GRCm39) missense probably benign 0.01
R7531:Kit UTSW 5 75,767,700 (GRCm39) missense probably damaging 0.99
R7711:Kit UTSW 5 75,798,019 (GRCm39) missense probably damaging 0.97
R7810:Kit UTSW 5 75,769,982 (GRCm39) missense probably benign 0.11
R7819:Kit UTSW 5 75,806,592 (GRCm39) missense probably benign 0.41
R8021:Kit UTSW 5 75,776,151 (GRCm39) missense possibly damaging 0.79
R8139:Kit UTSW 5 75,813,465 (GRCm39) missense probably damaging 0.99
R8165:Kit UTSW 5 75,781,540 (GRCm39) missense possibly damaging 0.94
R8249:Kit UTSW 5 75,802,068 (GRCm39) missense probably damaging 0.97
R8288:Kit UTSW 5 75,815,149 (GRCm39) missense probably damaging 1.00
R8290:Kit UTSW 5 75,801,829 (GRCm39) missense probably benign
R8829:Kit UTSW 5 75,799,791 (GRCm39) missense probably benign 0.41
R8832:Kit UTSW 5 75,799,791 (GRCm39) missense probably benign 0.41
R8969:Kit UTSW 5 75,799,722 (GRCm39) missense
R9081:Kit UTSW 5 75,801,218 (GRCm39) missense probably benign
R9146:Kit UTSW 5 75,810,305 (GRCm39) missense probably damaging 1.00
R9631:Kit UTSW 5 75,767,689 (GRCm39) missense possibly damaging 0.95
U24488:Kit UTSW 5 75,783,674 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGCAGGCTTCTATTTGGC -3'
(R):5'- CATCAGCAGACTAGTATGGGATGAG -3'

Sequencing Primer
(F):5'- GCAGGCTTCTATTTGGCTTACC -3'
(R):5'- AGACTAGTATGGGATGAGTTTGTGAC -3'
Posted On 2022-02-07