Incidental Mutation 'R9232:Trim56'
ID 700292
Institutional Source Beutler Lab
Gene Symbol Trim56
Ensembl Gene ENSMUSG00000043279
Gene Name tripartite motif-containing 56
Synonyms RNF109, A130009K11Rik, LOC384309
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 137105644-137116209 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137112778 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 628 (V628A)
Ref Sequence ENSEMBL: ENSMUSP00000058109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054384] [ENSMUST00000152207]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000054384
AA Change: V628A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058109
Gene: ENSMUSG00000043279
AA Change: V628A

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 1.9e-7 PFAM
coiled coil region 257 291 N/A INTRINSIC
low complexity region 302 309 N/A INTRINSIC
low complexity region 381 399 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152207
SMART Domains Protein: ENSMUSP00000117874
Gene: ENSMUSG00000043279

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Trim56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Trim56 APN 5 137114500 missense possibly damaging 0.95
IGL02604:Trim56 APN 5 137113076 missense probably damaging 0.98
IGL02653:Trim56 APN 5 137112906 missense probably damaging 1.00
IGL03069:Trim56 APN 5 137113762 missense probably damaging 0.99
R0711:Trim56 UTSW 5 137112992 missense probably benign 0.00
R1167:Trim56 UTSW 5 137112520 missense probably damaging 0.98
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1508:Trim56 UTSW 5 137113937 missense probably benign 0.00
R1791:Trim56 UTSW 5 137114398 missense probably damaging 1.00
R2484:Trim56 UTSW 5 137112674 missense possibly damaging 0.95
R4274:Trim56 UTSW 5 137113687 missense probably damaging 1.00
R4579:Trim56 UTSW 5 137114064 missense possibly damaging 0.60
R4766:Trim56 UTSW 5 137112725 missense probably benign 0.07
R4932:Trim56 UTSW 5 137114489 missense probably damaging 1.00
R5117:Trim56 UTSW 5 137113978 missense probably benign 0.13
R6444:Trim56 UTSW 5 137112616 missense probably damaging 0.99
R6747:Trim56 UTSW 5 137114521 missense probably damaging 1.00
R6962:Trim56 UTSW 5 137112647 missense probably damaging 0.97
R7115:Trim56 UTSW 5 137113660 missense probably damaging 0.98
R7266:Trim56 UTSW 5 137114243 missense probably damaging 0.98
R7706:Trim56 UTSW 5 137114656 missense probably benign 0.00
R8347:Trim56 UTSW 5 137112592 missense probably damaging 1.00
R8492:Trim56 UTSW 5 137112929 missense probably benign
R8695:Trim56 UTSW 5 137114575 missense probably benign 0.15
R9152:Trim56 UTSW 5 137114533 missense probably benign 0.06
R9166:Trim56 UTSW 5 137113897 missense probably damaging 1.00
X0019:Trim56 UTSW 5 137114210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATCCAGTATCACCACCTTG -3'
(R):5'- CCTGACGGAGAAATTCAGTGG -3'

Sequencing Primer
(F):5'- GGATCCAGTATCACCACCTTGTTTAC -3'
(R):5'- AAATTCAGTGGCGCAGGTCC -3'
Posted On 2022-02-07