Mutagenetix > Incidental Mutation

Incidental Mutation 'R9232:Cntn6'

700295

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R9232 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104838820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 721 (W721R)

Ref Sequence

ENSEMBL: ENSMUSP00000086623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000089215
AA Change: W721R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: W721R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161070
AA Change: W649R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: W649R

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162872
AA Change: W721R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: W721R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	A	T	18: 10,652,198	S278T	probably benign	Het
Adgrf1	T	C	17: 43,310,404	Y511H	probably benign	Het
Atp5h	A	G	11: 115,418,395	F38S	probably benign	Het
Cdc6	T	G	11: 98,910,375	S151A	probably benign	Het
Ceacam12	T	A	7: 18,069,416	M249K	probably benign	Het
Cenpt	T	C	8: 105,845,161	Q446R	probably damaging	Het
Cnnm1	T	A	19: 43,491,886	S883T	probably benign	Het
Defb43	A	G	14: 63,017,832	K38R	probably damaging	Het
Eif2a	T	C	3: 58,555,601	S522P	probably benign	Het
Erap1	T	G	13: 74,663,518	S332R	probably benign	Het
Foxa3	C	A	7: 19,014,865	R112L	probably damaging	Het
Foxf1	T	A	8: 121,084,976	M193K	possibly damaging	Het
Gbp11	T	C	5: 105,328,424	Y273C	possibly damaging	Het
Gli2	T	A	1: 118,836,291	T1377S	probably benign	Het
Gm10271	T	A	10: 116,972,574	L12F	probably damaging	Het
Gm13023	T	G	4: 143,793,693	L169R	probably benign	Het
Grm5	G	A	7: 88,074,383	G627D	probably damaging	Het
Gtf3c4	A	G	2: 28,834,836	S295P	probably damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Igsf10	G	A	3: 59,336,422	R164W	probably damaging	Het
Iqch	T	A	9: 63,421,918	M1045L	probably benign	Het
Kcnt2	T	C	1: 140,484,193	S455P	possibly damaging	Het
Kif26b	G	A	1: 178,914,946	G869E	probably damaging	Het
Kit	A	G	5: 75,639,132	N508S	probably benign	Het
Lgals8	C	T	13: 12,454,896	V61M	probably damaging	Het
Lztr1	T	C	16: 17,521,479	V392A	possibly damaging	Het
Mad1l1	T	A	5: 140,105,541	M524L	probably benign	Het
Mob3b	T	C	4: 34,986,101	N146D	probably benign	Het
Muc16	T	C	9: 18,656,040	T1728A	unknown	Het
Nlgn2	T	C	11: 69,828,029	H278R	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Plce1	A	G	19: 38,716,979	M943V	probably benign	Het
Proser2	A	G	2: 6,101,204	L183P	probably benign	Het
Prss36	T	C	7: 127,944,816	I128V	probably benign	Het
Rabggta	C	T	14: 55,719,288	V320I	probably benign	Het
Sepsecs	A	G	5: 52,666,002	V125A	probably benign	Het
Sik3	C	T	9: 46,211,918	P1005L	probably benign	Het
Slc22a20	A	T	19: 5,972,981	I378N	possibly damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Tap1	T	C	17: 34,193,303	V494A	probably benign	Het
Tg	A	G	15: 66,698,461	D1394G	probably benign	Het
Tgfbr3	T	C	5: 107,142,495	T315A	possibly damaging	Het
Tmc2	A	G	2: 130,243,129	T559A	probably damaging	Het
Tph1	A	G	7: 46,662,105	I71T	probably benign	Het
Trib3	A	T	2: 152,343,042	C96S	probably damaging	Het
Trim28	G	A	7: 13,029,563	A544T	probably benign	Het
Trim56	A	G	5: 137,112,778	V628A	probably damaging	Het
Ttc6	A	G	12: 57,729,424	Y1718C	probably damaging	Het
Tuft1	T	C	3: 94,622,138	Q244R	probably benign	Het
Unc13b	A	G	4: 43,240,321	T793A	probably benign	Het
Vmn1r39	A	G	6: 66,804,596	I246T	possibly damaging	Het
Xpo1	T	C	11: 23,282,646	S389P	probably benign	Het
Zdbf2	T	C	1: 63,308,009	F1849S	possibly damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGTTTGCCAGGATGAGC -3'
(R):5'- GTGCTGAGTTTGTCACATTCTC -3'

Sequencing Primer
(F):5'- GCGCTTTGAAAGGTGAAACCCTC -3'
(R):5'- CTTGCTTTACTGGAAATAAGAACTGC -3'

Posted On

2022-02-07