Incidental Mutation 'R9232:Grm5'
ID 700300
Institutional Source Beutler Lab
Gene Symbol Grm5
Ensembl Gene ENSMUSG00000049583
Gene Name glutamate receptor, metabotropic 5
Synonyms Glu5R, mGluR5, 6430542K11Rik, Gprc1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 87584168-88134907 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 88074383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 627 (G627D)
Ref Sequence ENSEMBL: ENSMUSP00000114927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]
AlphaFold Q3UVX5
Predicted Effect probably damaging
Transcript: ENSMUST00000107263
AA Change: G627D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: G627D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.4e-97 PFAM
Pfam:Peripla_BP_6 130 332 2.5e-14 PFAM
Pfam:NCD3G 506 557 4.5e-20 PFAM
Pfam:7tm_3 588 824 7.4e-75 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125009
AA Change: G627D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: G627D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 5.7e-101 PFAM
Pfam:Peripla_BP_6 129 327 5.4e-12 PFAM
Pfam:NCD3G 506 557 3.2e-16 PFAM
Pfam:7tm_3 590 823 3.5e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 929 954 N/A INTRINSIC
low complexity region 968 987 N/A INTRINSIC
low complexity region 1046 1056 N/A INTRINSIC
GluR_Homer-bdg 1121 1171 1.42e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155358
AA Change: G627D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: G627D

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:ANF_receptor 67 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 129 327 2.5e-12 PFAM
Pfam:NCD3G 506 557 9.4e-17 PFAM
Pfam:7tm_3 590 823 1.3e-56 PFAM
low complexity region 851 860 N/A INTRINSIC
low complexity region 961 986 N/A INTRINSIC
low complexity region 1000 1019 N/A INTRINSIC
low complexity region 1078 1088 N/A INTRINSIC
GluR_Homer-bdg 1153 1203 1.42e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Grm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Grm5 APN 7 88130781 missense probably benign 0.00
IGL00970:Grm5 APN 7 87803896 missense probably damaging 0.97
IGL01286:Grm5 APN 7 87602565 missense probably benign 0.00
IGL01307:Grm5 APN 7 88075012 missense probably damaging 1.00
IGL01603:Grm5 APN 7 87603178 missense probably damaging 1.00
IGL01646:Grm5 APN 7 88040059 missense probably damaging 1.00
IGL01705:Grm5 APN 7 88130046 missense possibly damaging 0.59
IGL02184:Grm5 APN 7 88026442 missense probably damaging 0.98
IGL02504:Grm5 APN 7 88130772 missense probably benign
IGL02689:Grm5 APN 7 87602710 missense probably damaging 1.00
IGL02725:Grm5 APN 7 88074665 missense probably damaging 1.00
IGL02851:Grm5 APN 7 88074710 missense probably damaging 0.98
IGL03106:Grm5 APN 7 88036070 missense probably damaging 1.00
IGL03257:Grm5 APN 7 87602898 missense possibly damaging 0.69
IGL03291:Grm5 APN 7 88130796 missense probably damaging 1.00
BB004:Grm5 UTSW 7 88036174 missense probably benign 0.16
BB014:Grm5 UTSW 7 88036174 missense probably benign 0.16
R0078:Grm5 UTSW 7 88074977 missense probably damaging 1.00
R0314:Grm5 UTSW 7 87602955 missense probably damaging 0.97
R0318:Grm5 UTSW 7 87602967 missense probably damaging 0.99
R0364:Grm5 UTSW 7 88074386 missense probably damaging 1.00
R0380:Grm5 UTSW 7 88074376 missense possibly damaging 0.92
R0454:Grm5 UTSW 7 88130789 missense probably damaging 1.00
R0494:Grm5 UTSW 7 88130781 missense probably benign 0.00
R0562:Grm5 UTSW 7 87603019 missense probably damaging 1.00
R1695:Grm5 UTSW 7 88036103 missense possibly damaging 0.47
R2012:Grm5 UTSW 7 88074872 missense probably damaging 1.00
R2384:Grm5 UTSW 7 87602728 missense probably damaging 1.00
R2510:Grm5 UTSW 7 88036091 missense probably benign 0.21
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R2870:Grm5 UTSW 7 87602722 missense possibly damaging 0.85
R3861:Grm5 UTSW 7 88129994 missense possibly damaging 0.94
R4451:Grm5 UTSW 7 88075132 critical splice donor site probably null
R4626:Grm5 UTSW 7 88130153 missense probably damaging 1.00
R4728:Grm5 UTSW 7 87975288 missense probably damaging 1.00
R4914:Grm5 UTSW 7 88130129 missense probably benign 0.00
R5122:Grm5 UTSW 7 88074820 missense probably damaging 1.00
R5352:Grm5 UTSW 7 88074850 missense probably damaging 1.00
R5361:Grm5 UTSW 7 88074496 missense probably damaging 1.00
R5684:Grm5 UTSW 7 88130645 missense probably benign
R5715:Grm5 UTSW 7 88130256 missense probably benign 0.05
R5759:Grm5 UTSW 7 88026600 missense probably damaging 0.96
R5844:Grm5 UTSW 7 87804024 missense possibly damaging 0.88
R5889:Grm5 UTSW 7 87603073 missense probably damaging 1.00
R6048:Grm5 UTSW 7 88026550 missense probably damaging 1.00
R6145:Grm5 UTSW 7 88026601 missense probably damaging 1.00
R6232:Grm5 UTSW 7 87602430 unclassified probably benign
R6972:Grm5 UTSW 7 87602923 missense probably benign 0.02
R7072:Grm5 UTSW 7 88074304 missense probably damaging 1.00
R7258:Grm5 UTSW 7 88074706 missense probably damaging 0.96
R7316:Grm5 UTSW 7 87975265 missense probably benign
R7434:Grm5 UTSW 7 88130474 missense probably benign 0.10
R7521:Grm5 UTSW 7 88074272 missense possibly damaging 0.86
R7616:Grm5 UTSW 7 88116201 missense probably benign
R7631:Grm5 UTSW 7 87975305 missense probably damaging 1.00
R7655:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7656:Grm5 UTSW 7 88130251 missense probably benign 0.00
R7739:Grm5 UTSW 7 88130058 missense possibly damaging 0.46
R7897:Grm5 UTSW 7 88130861 missense probably benign 0.14
R7927:Grm5 UTSW 7 88036174 missense probably benign 0.16
R7967:Grm5 UTSW 7 87975361 missense probably damaging 0.99
R8260:Grm5 UTSW 7 88075132 critical splice donor site probably null
R8345:Grm5 UTSW 7 88074538 missense probably damaging 1.00
R8460:Grm5 UTSW 7 87603041 missense probably damaging 1.00
R8473:Grm5 UTSW 7 87603070 missense probably damaging 0.97
R8531:Grm5 UTSW 7 88130516 missense probably benign 0.05
R8671:Grm5 UTSW 7 88116290 critical splice donor site probably null
R8805:Grm5 UTSW 7 87803968 missense probably damaging 1.00
R9036:Grm5 UTSW 7 88036189 missense possibly damaging 0.94
R9106:Grm5 UTSW 7 88074539 missense probably damaging 1.00
R9136:Grm5 UTSW 7 88040046 missense possibly damaging 0.95
R9189:Grm5 UTSW 7 88074816 missense probably damaging 1.00
R9196:Grm5 UTSW 7 88074310 missense probably damaging 1.00
R9234:Grm5 UTSW 7 88074232 missense probably damaging 1.00
R9384:Grm5 UTSW 7 88074310 missense probably damaging 1.00
R9424:Grm5 UTSW 7 88116276 missense probably benign 0.00
R9531:Grm5 UTSW 7 88130867 makesense probably null
Z1176:Grm5 UTSW 7 87602715 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGTGATTTGATCCCAGTCC -3'
(R):5'- GAAAGCGATCACTAACTGAGC -3'

Sequencing Primer
(F):5'- CCAGTCCAGTATCTTCGATGGG -3'
(R):5'- ACAGGCGCTCATGAATCTG -3'
Posted On 2022-02-07