Mutagenetix > Incidental Mutation

Incidental Mutation 'R9232:Grm5'

700300

Institutional Source

Beutler Lab

Gene Symbol

Grm5

Ensembl Gene

ENSMUSG00000049583

Gene Name

glutamate receptor, metabotropic 5

Synonyms

Glu5R, mGluR5, 6430542K11Rik, Gprc1e

MMRRC Submission

068986-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.296) question?

Stock #

R9232 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87584168-88134907 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88074383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 627 (G627D)

Ref Sequence

ENSEMBL: ENSMUSP00000114927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107263] [ENSMUST00000125009] [ENSMUST00000155358]

AlphaFold

Q3UVX5

Predicted Effect

probably damaging
Transcript: ENSMUST00000107263
AA Change: G627D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102884
Gene: ENSMUSG00000049583
AA Change: G627D

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.4e-97	PFAM
Pfam:Peripla_BP_6	130	332	2.5e-14	PFAM
Pfam:NCD3G	506	557	4.5e-20	PFAM
Pfam:7tm_3	588	824	7.4e-75	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125009
AA Change: G627D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118393
Gene: ENSMUSG00000049583
AA Change: G627D

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	5.7e-101	PFAM
Pfam:Peripla_BP_6	129	327	5.4e-12	PFAM
Pfam:NCD3G	506	557	3.2e-16	PFAM
Pfam:7tm_3	590	823	3.5e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	929	954	N/A	INTRINSIC
low complexity region	968	987	N/A	INTRINSIC
low complexity region	1046	1056	N/A	INTRINSIC
GluR_Homer-bdg	1121	1171	1.42e-24	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000155358
AA Change: G627D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114927
Gene: ENSMUSG00000049583
AA Change: G627D

Domain	Start	End	E-Value	Type
low complexity region	2	12	N/A	INTRINSIC
Pfam:ANF_receptor	67	471	4.1e-101	PFAM
Pfam:Peripla_BP_6	129	327	2.5e-12	PFAM
Pfam:NCD3G	506	557	9.4e-17	PFAM
Pfam:7tm_3	590	823	1.3e-56	PFAM
low complexity region	851	860	N/A	INTRINSIC
low complexity region	961	986	N/A	INTRINSIC
low complexity region	1000	1019	N/A	INTRINSIC
low complexity region	1078	1088	N/A	INTRINSIC
GluR_Homer-bdg	1153	1203	1.42e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor 3 protein family. The encoded protein is a metabatropic glutamate receptor, whose signaling activates a phosphatidylinositol-calcium second messenger system. This protein may be involved in the regulation of neural network activity and synaptic plasticity. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. A pseudogene of this gene has been defined on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice have reduced corticostriatal long term potentiation, do not exhibit hyperactivity after cocaine consumption and do not self-administer cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	A	T	18: 10,652,198	S278T	probably benign	Het
Adgrf1	T	C	17: 43,310,404	Y511H	probably benign	Het
Atp5h	A	G	11: 115,418,395	F38S	probably benign	Het
Cdc6	T	G	11: 98,910,375	S151A	probably benign	Het
Ceacam12	T	A	7: 18,069,416	M249K	probably benign	Het
Cenpt	T	C	8: 105,845,161	Q446R	probably damaging	Het
Cnnm1	T	A	19: 43,491,886	S883T	probably benign	Het
Cntn6	T	C	6: 104,838,820	W721R	probably damaging	Het
Defb43	A	G	14: 63,017,832	K38R	probably damaging	Het
Eif2a	T	C	3: 58,555,601	S522P	probably benign	Het
Erap1	T	G	13: 74,663,518	S332R	probably benign	Het
Foxa3	C	A	7: 19,014,865	R112L	probably damaging	Het
Foxf1	T	A	8: 121,084,976	M193K	possibly damaging	Het
Gbp11	T	C	5: 105,328,424	Y273C	possibly damaging	Het
Gli2	T	A	1: 118,836,291	T1377S	probably benign	Het
Gm10271	T	A	10: 116,972,574	L12F	probably damaging	Het
Gm13023	T	G	4: 143,793,693	L169R	probably benign	Het
Gtf3c4	A	G	2: 28,834,836	S295P	probably damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Igsf10	G	A	3: 59,336,422	R164W	probably damaging	Het
Iqch	T	A	9: 63,421,918	M1045L	probably benign	Het
Kcnt2	T	C	1: 140,484,193	S455P	possibly damaging	Het
Kif26b	G	A	1: 178,914,946	G869E	probably damaging	Het
Kit	A	G	5: 75,639,132	N508S	probably benign	Het
Lgals8	C	T	13: 12,454,896	V61M	probably damaging	Het
Lztr1	T	C	16: 17,521,479	V392A	possibly damaging	Het
Mad1l1	T	A	5: 140,105,541	M524L	probably benign	Het
Mob3b	T	C	4: 34,986,101	N146D	probably benign	Het
Muc16	T	C	9: 18,656,040	T1728A	unknown	Het
Nlgn2	T	C	11: 69,828,029	H278R	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Plce1	A	G	19: 38,716,979	M943V	probably benign	Het
Proser2	A	G	2: 6,101,204	L183P	probably benign	Het
Prss36	T	C	7: 127,944,816	I128V	probably benign	Het
Rabggta	C	T	14: 55,719,288	V320I	probably benign	Het
Sepsecs	A	G	5: 52,666,002	V125A	probably benign	Het
Sik3	C	T	9: 46,211,918	P1005L	probably benign	Het
Slc22a20	A	T	19: 5,972,981	I378N	possibly damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Tap1	T	C	17: 34,193,303	V494A	probably benign	Het
Tg	A	G	15: 66,698,461	D1394G	probably benign	Het
Tgfbr3	T	C	5: 107,142,495	T315A	possibly damaging	Het
Tmc2	A	G	2: 130,243,129	T559A	probably damaging	Het
Tph1	A	G	7: 46,662,105	I71T	probably benign	Het
Trib3	A	T	2: 152,343,042	C96S	probably damaging	Het
Trim28	G	A	7: 13,029,563	A544T	probably benign	Het
Trim56	A	G	5: 137,112,778	V628A	probably damaging	Het
Ttc6	A	G	12: 57,729,424	Y1718C	probably damaging	Het
Tuft1	T	C	3: 94,622,138	Q244R	probably benign	Het
Unc13b	A	G	4: 43,240,321	T793A	probably benign	Het
Vmn1r39	A	G	6: 66,804,596	I246T	possibly damaging	Het
Xpo1	T	C	11: 23,282,646	S389P	probably benign	Het
Zdbf2	T	C	1: 63,308,009	F1849S	possibly damaging	Het

Other mutations in Grm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Grm5	APN	7	88130781	missense	probably benign	0.00
IGL00970:Grm5	APN	7	87803896	missense	probably damaging	0.97
IGL01286:Grm5	APN	7	87602565	missense	probably benign	0.00
IGL01307:Grm5	APN	7	88075012	missense	probably damaging	1.00
IGL01603:Grm5	APN	7	87603178	missense	probably damaging	1.00
IGL01646:Grm5	APN	7	88040059	missense	probably damaging	1.00
IGL01705:Grm5	APN	7	88130046	missense	possibly damaging	0.59
IGL02184:Grm5	APN	7	88026442	missense	probably damaging	0.98
IGL02504:Grm5	APN	7	88130772	missense	probably benign
IGL02689:Grm5	APN	7	87602710	missense	probably damaging	1.00
IGL02725:Grm5	APN	7	88074665	missense	probably damaging	1.00
IGL02851:Grm5	APN	7	88074710	missense	probably damaging	0.98
IGL03106:Grm5	APN	7	88036070	missense	probably damaging	1.00
IGL03257:Grm5	APN	7	87602898	missense	possibly damaging	0.69
IGL03291:Grm5	APN	7	88130796	missense	probably damaging	1.00
BB004:Grm5	UTSW	7	88036174	missense	probably benign	0.16
BB014:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R0078:Grm5	UTSW	7	88074977	missense	probably damaging	1.00
R0314:Grm5	UTSW	7	87602955	missense	probably damaging	0.97
R0318:Grm5	UTSW	7	87602967	missense	probably damaging	0.99
R0364:Grm5	UTSW	7	88074386	missense	probably damaging	1.00
R0380:Grm5	UTSW	7	88074376	missense	possibly damaging	0.92
R0454:Grm5	UTSW	7	88130789	missense	probably damaging	1.00
R0494:Grm5	UTSW	7	88130781	missense	probably benign	0.00
R0562:Grm5	UTSW	7	87603019	missense	probably damaging	1.00
R1695:Grm5	UTSW	7	88036103	missense	possibly damaging	0.47
R2012:Grm5	UTSW	7	88074872	missense	probably damaging	1.00
R2384:Grm5	UTSW	7	87602728	missense	probably damaging	1.00
R2510:Grm5	UTSW	7	88036091	missense	probably benign	0.21
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R2870:Grm5	UTSW	7	87602722	missense	possibly damaging	0.85
R3861:Grm5	UTSW	7	88129994	missense	possibly damaging	0.94
R4451:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R4626:Grm5	UTSW	7	88130153	missense	probably damaging	1.00
R4728:Grm5	UTSW	7	87975288	missense	probably damaging	1.00
R4914:Grm5	UTSW	7	88130129	missense	probably benign	0.00
R5122:Grm5	UTSW	7	88074820	missense	probably damaging	1.00
R5352:Grm5	UTSW	7	88074850	missense	probably damaging	1.00
R5361:Grm5	UTSW	7	88074496	missense	probably damaging	1.00
R5684:Grm5	UTSW	7	88130645	missense	probably benign
R5715:Grm5	UTSW	7	88130256	missense	probably benign	0.05
R5759:Grm5	UTSW	7	88026600	missense	probably damaging	0.96
R5844:Grm5	UTSW	7	87804024	missense	possibly damaging	0.88
R5889:Grm5	UTSW	7	87603073	missense	probably damaging	1.00
R6048:Grm5	UTSW	7	88026550	missense	probably damaging	1.00
R6145:Grm5	UTSW	7	88026601	missense	probably damaging	1.00
R6232:Grm5	UTSW	7	87602430	unclassified	probably benign
R6972:Grm5	UTSW	7	87602923	missense	probably benign	0.02
R7072:Grm5	UTSW	7	88074304	missense	probably damaging	1.00
R7258:Grm5	UTSW	7	88074706	missense	probably damaging	0.96
R7316:Grm5	UTSW	7	87975265	missense	probably benign
R7434:Grm5	UTSW	7	88130474	missense	probably benign	0.10
R7521:Grm5	UTSW	7	88074272	missense	possibly damaging	0.86
R7616:Grm5	UTSW	7	88116201	missense	probably benign
R7631:Grm5	UTSW	7	87975305	missense	probably damaging	1.00
R7655:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7656:Grm5	UTSW	7	88130251	missense	probably benign	0.00
R7739:Grm5	UTSW	7	88130058	missense	possibly damaging	0.46
R7897:Grm5	UTSW	7	88130861	missense	probably benign	0.14
R7927:Grm5	UTSW	7	88036174	missense	probably benign	0.16
R7967:Grm5	UTSW	7	87975361	missense	probably damaging	0.99
R8260:Grm5	UTSW	7	88075132	critical splice donor site	probably null
R8345:Grm5	UTSW	7	88074538	missense	probably damaging	1.00
R8460:Grm5	UTSW	7	87603041	missense	probably damaging	1.00
R8473:Grm5	UTSW	7	87603070	missense	probably damaging	0.97
R8531:Grm5	UTSW	7	88130516	missense	probably benign	0.05
R8671:Grm5	UTSW	7	88116290	critical splice donor site	probably null
R8805:Grm5	UTSW	7	87803968	missense	probably damaging	1.00
R9036:Grm5	UTSW	7	88036189	missense	possibly damaging	0.94
R9106:Grm5	UTSW	7	88074539	missense	probably damaging	1.00
R9136:Grm5	UTSW	7	88040046	missense	possibly damaging	0.95
R9189:Grm5	UTSW	7	88074816	missense	probably damaging	1.00
R9196:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9234:Grm5	UTSW	7	88074232	missense	probably damaging	1.00
R9384:Grm5	UTSW	7	88074310	missense	probably damaging	1.00
R9424:Grm5	UTSW	7	88116276	missense	probably benign	0.00
R9531:Grm5	UTSW	7	88130867	makesense	probably null
R9631:Grm5	UTSW	7	87975352	missense	probably damaging	0.98
R9691:Grm5	UTSW	7	88074695	missense	probably damaging	1.00
Z1176:Grm5	UTSW	7	87602715	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGTGATTTGATCCCAGTCC -3'
(R):5'- GAAAGCGATCACTAACTGAGC -3'

Sequencing Primer
(F):5'- CCAGTCCAGTATCTTCGATGGG -3'
(R):5'- ACAGGCGCTCATGAATCTG -3'

Posted On

2022-02-07