Incidental Mutation 'R9232:Foxf1'
ID 700303
Institutional Source Beutler Lab
Gene Symbol Foxf1
Ensembl Gene ENSMUSG00000042812
Gene Name forkhead box F1
Synonyms FREAC1, Hfh8, Freac-1, Foxf1a, Foxf1, HFH-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 121084386-121088144 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121084976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 193 (M193K)
Ref Sequence ENSEMBL: ENSMUSP00000137662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127664] [ENSMUST00000181504]
AlphaFold Q61080
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000181504
AA Change: M193K

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137662
Gene: ENSMUSG00000042812
AA Change: M193K

DomainStartEndE-ValueType
low complexity region 12 42 N/A INTRINSIC
FH 46 136 6.02e-59 SMART
low complexity region 137 146 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
Meta Mutation Damage Score 0.0983 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the regulation of pulmonary genes as well as embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in mid-gestation lethality, defects in extraembryonic and lateral plate mesoderm differentiation, failure of embryo turning, absence of yolk sac and allantois vasculogenesis, retarded somite and posterior embryo development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Foxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Foxf1 APN 8 121085345 missense probably damaging 0.99
IGL02113:Foxf1 APN 8 121084565 missense probably damaging 1.00
IGL03167:Foxf1 APN 8 121084908 nonsense probably null
R0359:Foxf1 UTSW 8 121085003 missense possibly damaging 0.69
R0621:Foxf1 UTSW 8 121085180 missense probably damaging 0.98
R1523:Foxf1 UTSW 8 121084558 splice site probably null
R4854:Foxf1 UTSW 8 121086814 missense probably benign
R5435:Foxf1 UTSW 8 121084492 missense probably damaging 0.99
R6423:Foxf1 UTSW 8 121085095 missense possibly damaging 0.90
R7582:Foxf1 UTSW 8 121084691 missense possibly damaging 0.94
R7853:Foxf1 UTSW 8 121084699 missense probably damaging 0.99
R8095:Foxf1 UTSW 8 121086812 missense probably benign 0.01
R8168:Foxf1 UTSW 8 121085162 missense probably damaging 0.98
R8841:Foxf1 UTSW 8 121085180 missense probably damaging 0.98
Z1176:Foxf1 UTSW 8 121084529 missense probably damaging 0.99
Z1177:Foxf1 UTSW 8 121084435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGCTAGCGAGTTTATGTTC -3'
(R):5'- CTGCAGAGCTGGAGTAAACG -3'

Sequencing Primer
(F):5'- TTCGAGGAGGGCTCGTTCC -3'
(R):5'- CTGGAGTAAACGGCGTGC -3'
Posted On 2022-02-07