Mutagenetix > Incidental Mutation

Incidental Mutation 'R9232:Xpo1'

700308

Institutional Source

Beutler Lab

Gene Symbol

Xpo1

Ensembl Gene

ENSMUSG00000020290

Gene Name

exportin 1

Synonyms

Crm1

MMRRC Submission

068986-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9232 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

23256041-23298249 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23282646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 389 (S389P)

Ref Sequence

ENSEMBL: ENSMUSP00000105178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]

AlphaFold

Q6P5F9

PDB Structure

Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000020538
AA Change: S389P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: S389P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102869
AA Change: S389P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: S389P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	7.4e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102870
AA Change: S389P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: S389P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109551
AA Change: S389P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: S389P

Domain	Start	End	E-Value	Type
IBN_N	46	112	2.3e-10	SMART
Pfam:Xpo1	123	268	1.3e-44	PFAM
Blast:IL1	407	518	9e-14	BLAST
Blast:CRM1_C	590	699	1e-22	BLAST
CRM1_C	709	1027	4.63e-211	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150750

SMART Domains

Protein: ENSMUSP00000117846
Gene: ENSMUSG00000020290

Domain	Start	End	E-Value	Type
Blast:CRM1_C	97	136	3e-8	BLAST
Pfam:CRM1_C	171	233	4.3e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd3	A	T	18: 10,652,198	S278T	probably benign	Het
Adgrf1	T	C	17: 43,310,404	Y511H	probably benign	Het
Atp5h	A	G	11: 115,418,395	F38S	probably benign	Het
Cdc6	T	G	11: 98,910,375	S151A	probably benign	Het
Ceacam12	T	A	7: 18,069,416	M249K	probably benign	Het
Cenpt	T	C	8: 105,845,161	Q446R	probably damaging	Het
Cnnm1	T	A	19: 43,491,886	S883T	probably benign	Het
Cntn6	T	C	6: 104,838,820	W721R	probably damaging	Het
Defb43	A	G	14: 63,017,832	K38R	probably damaging	Het
Eif2a	T	C	3: 58,555,601	S522P	probably benign	Het
Erap1	T	G	13: 74,663,518	S332R	probably benign	Het
Foxa3	C	A	7: 19,014,865	R112L	probably damaging	Het
Foxf1	T	A	8: 121,084,976	M193K	possibly damaging	Het
Gbp11	T	C	5: 105,328,424	Y273C	possibly damaging	Het
Gli2	T	A	1: 118,836,291	T1377S	probably benign	Het
Gm10271	T	A	10: 116,972,574	L12F	probably damaging	Het
Gm13023	T	G	4: 143,793,693	L169R	probably benign	Het
Grm5	G	A	7: 88,074,383	G627D	probably damaging	Het
Gtf3c4	A	G	2: 28,834,836	S295P	probably damaging	Het
Hps4	G	A	5: 112,378,039	S642N	possibly damaging	Het
Igsf10	G	A	3: 59,336,422	R164W	probably damaging	Het
Iqch	T	A	9: 63,421,918	M1045L	probably benign	Het
Kcnt2	T	C	1: 140,484,193	S455P	possibly damaging	Het
Kif26b	G	A	1: 178,914,946	G869E	probably damaging	Het
Kit	A	G	5: 75,639,132	N508S	probably benign	Het
Lgals8	C	T	13: 12,454,896	V61M	probably damaging	Het
Lztr1	T	C	16: 17,521,479	V392A	possibly damaging	Het
Mad1l1	T	A	5: 140,105,541	M524L	probably benign	Het
Mob3b	T	C	4: 34,986,101	N146D	probably benign	Het
Muc16	T	C	9: 18,656,040	T1728A	unknown	Het
Nlgn2	T	C	11: 69,828,029	H278R	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Plce1	A	G	19: 38,716,979	M943V	probably benign	Het
Proser2	A	G	2: 6,101,204	L183P	probably benign	Het
Prss36	T	C	7: 127,944,816	I128V	probably benign	Het
Rabggta	C	T	14: 55,719,288	V320I	probably benign	Het
Sepsecs	A	G	5: 52,666,002	V125A	probably benign	Het
Sik3	C	T	9: 46,211,918	P1005L	probably benign	Het
Slc22a20	A	T	19: 5,972,981	I378N	possibly damaging	Het
Son	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC	16: 91,656,691		probably benign	Het
Tap1	T	C	17: 34,193,303	V494A	probably benign	Het
Tg	A	G	15: 66,698,461	D1394G	probably benign	Het
Tgfbr3	T	C	5: 107,142,495	T315A	possibly damaging	Het
Tmc2	A	G	2: 130,243,129	T559A	probably damaging	Het
Tph1	A	G	7: 46,662,105	I71T	probably benign	Het
Trib3	A	T	2: 152,343,042	C96S	probably damaging	Het
Trim28	G	A	7: 13,029,563	A544T	probably benign	Het
Trim56	A	G	5: 137,112,778	V628A	probably damaging	Het
Ttc6	A	G	12: 57,729,424	Y1718C	probably damaging	Het
Tuft1	T	C	3: 94,622,138	Q244R	probably benign	Het
Unc13b	A	G	4: 43,240,321	T793A	probably benign	Het
Vmn1r39	A	G	6: 66,804,596	I246T	possibly damaging	Het
Zdbf2	T	C	1: 63,308,009	F1849S	possibly damaging	Het

Other mutations in Xpo1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Xpo1	APN	11	23285094	missense	probably damaging	1.00
IGL01464:Xpo1	APN	11	23267703	missense	probably damaging	0.97
IGL01561:Xpo1	APN	11	23282706	missense	possibly damaging	0.76
IGL01630:Xpo1	APN	11	23285846	missense	probably benign	0.00
IGL01700:Xpo1	APN	11	23276422	splice site	probably benign
IGL02000:Xpo1	APN	11	23296003	missense	probably damaging	1.00
IGL02299:Xpo1	APN	11	23293915	splice site	probably benign
IGL02313:Xpo1	APN	11	23277065	missense	probably damaging	1.00
IGL02828:Xpo1	APN	11	23282593	missense	probably damaging	0.97
IGL03210:Xpo1	APN	11	23278834	missense	probably benign	0.01
IGL03329:Xpo1	APN	11	23284306	missense	probably benign
PIT1430001:Xpo1	UTSW	11	23276437	missense	possibly damaging	0.66
R0507:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R0594:Xpo1	UTSW	11	23280402	missense	probably damaging	1.00
R0706:Xpo1	UTSW	11	23280441	missense	probably benign	0.09
R0742:Xpo1	UTSW	11	23294682	missense	possibly damaging	0.61
R1385:Xpo1	UTSW	11	23261863	missense	probably damaging	0.96
R1478:Xpo1	UTSW	11	23291623	missense	probably damaging	0.99
R1483:Xpo1	UTSW	11	23284863	missense	probably benign	0.04
R1694:Xpo1	UTSW	11	23281399	missense	probably benign	0.12
R1775:Xpo1	UTSW	11	23271193	missense	probably benign
R1827:Xpo1	UTSW	11	23285155	missense	probably benign	0.00
R2262:Xpo1	UTSW	11	23284634	splice site	probably null
R2263:Xpo1	UTSW	11	23284634	splice site	probably null
R4510:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4511:Xpo1	UTSW	11	23287401	missense	possibly damaging	0.60
R4840:Xpo1	UTSW	11	23278183	missense	probably damaging	1.00
R4901:Xpo1	UTSW	11	23281327	missense	possibly damaging	0.62
R5176:Xpo1	UTSW	11	23295977	missense	probably damaging	0.99
R5508:Xpo1	UTSW	11	23294645	missense	probably benign
R5927:Xpo1	UTSW	11	23268653	unclassified	probably benign
R5927:Xpo1	UTSW	11	23268656	unclassified	probably benign
R6110:Xpo1	UTSW	11	23287434	missense	probably damaging	0.99
R6421:Xpo1	UTSW	11	23291490	missense	possibly damaging	0.60
R6591:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6691:Xpo1	UTSW	11	23286875	missense	probably damaging	1.00
R6698:Xpo1	UTSW	11	23294040	missense	probably benign	0.01
R6958:Xpo1	UTSW	11	23285855	missense	probably benign
R7407:Xpo1	UTSW	11	23285823	missense	probably damaging	1.00
R7482:Xpo1	UTSW	11	23282544	missense	probably benign	0.00
R7624:Xpo1	UTSW	11	23282584	missense	probably damaging	0.99
R8335:Xpo1	UTSW	11	23280603	splice site	probably null
R8823:Xpo1	UTSW	11	23267752	missense	probably benign
R9128:Xpo1	UTSW	11	23285058	missense	probably damaging	1.00
R9277:Xpo1	UTSW	11	23291550	missense	probably benign	0.17
Z1176:Xpo1	UTSW	11	23296080	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AATATCTGCTGCCCGTTTTCAG -3'
(R):5'- TGCAACAGGAAAACCTCTTAAGTTC -3'

Sequencing Primer
(F):5'- TAAGAGATCCACCTGGCTCTTGG -3'
(R):5'- CAGGAAAACCTCTTAAGTTCTACTTC -3'

Posted On

2022-02-07