Incidental Mutation 'R9232:Cnnm1'
ID 700325
Institutional Source Beutler Lab
Gene Symbol Cnnm1
Ensembl Gene ENSMUSG00000025189
Gene Name cyclin M1
Synonyms Acdp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R9232 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43440436-43497210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43491886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 883 (S883T)
Ref Sequence ENSEMBL: ENSMUSP00000131830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165311] [ENSMUST00000223787]
AlphaFold Q0GA42
Predicted Effect probably benign
Transcript: ENSMUST00000165311
AA Change: S883T

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131830
Gene: ENSMUSG00000025189
AA Change: S883T

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
low complexity region 78 95 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 165 183 N/A INTRINSIC
low complexity region 193 202 N/A INTRINSIC
Pfam:DUF21 224 414 1.8e-27 PFAM
Blast:CBS 438 489 2e-12 BLAST
CBS 505 561 5.02e0 SMART
Blast:cNMP 634 802 2e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000223787
AA Change: S904T

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1217 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ancient conserved domain protein family. The encoded protein may bind copper. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Cnnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Cnnm1 APN 19 43471936 missense probably benign 0.10
IGL02370:Cnnm1 APN 19 43471950 critical splice donor site probably null
R0329:Cnnm1 UTSW 19 43441910 missense probably damaging 1.00
R0400:Cnnm1 UTSW 19 43468364 missense probably damaging 1.00
R1417:Cnnm1 UTSW 19 43469723 missense probably benign 0.05
R1478:Cnnm1 UTSW 19 43471856 missense probably damaging 1.00
R1743:Cnnm1 UTSW 19 43471913 missense possibly damaging 0.93
R2290:Cnnm1 UTSW 19 43491502 missense probably benign
R2509:Cnnm1 UTSW 19 43441886 missense probably damaging 1.00
R2910:Cnnm1 UTSW 19 43469647 missense possibly damaging 0.58
R3107:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3109:Cnnm1 UTSW 19 43441561 missense probably damaging 0.97
R3922:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R3923:Cnnm1 UTSW 19 43440445 start codon destroyed probably null
R4804:Cnnm1 UTSW 19 43491575 missense probably benign 0.02
R5199:Cnnm1 UTSW 19 43494986 missense possibly damaging 0.84
R5347:Cnnm1 UTSW 19 43441862 missense probably benign 0.42
R5595:Cnnm1 UTSW 19 43465157 missense possibly damaging 0.85
R5964:Cnnm1 UTSW 19 43469723 missense probably benign 0.42
R5969:Cnnm1 UTSW 19 43491472 missense probably damaging 1.00
R6383:Cnnm1 UTSW 19 43465266 critical splice donor site probably null
R7072:Cnnm1 UTSW 19 43440857 missense probably benign
R7092:Cnnm1 UTSW 19 43441948 missense probably damaging 1.00
R7126:Cnnm1 UTSW 19 43484853 missense probably damaging 1.00
R7432:Cnnm1 UTSW 19 43468271 missense probably benign 0.09
R7445:Cnnm1 UTSW 19 43440821 missense possibly damaging 0.95
R8728:Cnnm1 UTSW 19 43484926 missense probably benign 0.00
R9108:Cnnm1 UTSW 19 43476210 missense possibly damaging 0.77
R9114:Cnnm1 UTSW 19 43440956 missense possibly damaging 0.51
R9131:Cnnm1 UTSW 19 43441400 missense probably benign
R9357:Cnnm1 UTSW 19 43441388 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTTGTGCCTCACAGAGCCC -3'
(R):5'- TGGTAAATGCTGACCCTGC -3'

Sequencing Primer
(F):5'- AGCCCAAGGTCTCCTCC -3'
(R):5'- GACCCTGCCCTCTTTTGTGTG -3'
Posted On 2022-02-07