Incidental Mutation 'R9232:Nlgn3'
ID 700326
Institutional Source Beutler Lab
Gene Symbol Nlgn3
Ensembl Gene ENSMUSG00000031302
Gene Name neuroligin 3
Synonyms NL3, A230085M13Rik, HNL3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9232 (G1)
Quality Score 221.999
Status Validated
Chromosome X
Chromosomal Location 101299168-101325963 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101308784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000066304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065858] [ENSMUST00000118111] [ENSMUST00000130555] [ENSMUST00000151528]
AlphaFold Q8BYM5
Predicted Effect probably damaging
Transcript: ENSMUST00000065858
AA Change: V179A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066304
Gene: ENSMUSG00000031302
AA Change: V179A

DomainStartEndE-ValueType
Pfam:COesterase 16 601 2.3e-194 PFAM
Pfam:Abhydrolase_3 180 342 1.7e-7 PFAM
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118111
AA Change: V65A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113863
Gene: ENSMUSG00000031302
AA Change: V65A

DomainStartEndE-ValueType
Pfam:COesterase 3 487 3.6e-161 PFAM
Pfam:Abhydrolase_3 66 232 2.4e-7 PFAM
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130555
AA Change: V159A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122213
Gene: ENSMUSG00000031302
AA Change: V159A

DomainStartEndE-ValueType
Pfam:COesterase 16 510 4.6e-179 PFAM
Pfam:Abhydrolase_3 160 323 1.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151528
AA Change: V199A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123283
Gene: ENSMUSG00000031302
AA Change: V199A

DomainStartEndE-ValueType
Pfam:COesterase 16 621 3.4e-207 PFAM
Pfam:Abhydrolase_3 200 363 1.2e-6 PFAM
transmembrane domain 705 727 N/A INTRINSIC
Meta Mutation Damage Score 0.9671 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice show impaired context and cued conditioning, hyperactivity, altered social behavior, less vocalization, smaller brains, and impaired olfaction. Males carrying a knock-in allele show impaired social interaction, and enhanced spatial learning and inhibitory synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd3 A T 18: 10,652,198 S278T probably benign Het
Adgrf1 T C 17: 43,310,404 Y511H probably benign Het
Atp5h A G 11: 115,418,395 F38S probably benign Het
Cdc6 T G 11: 98,910,375 S151A probably benign Het
Ceacam12 T A 7: 18,069,416 M249K probably benign Het
Cenpt T C 8: 105,845,161 Q446R probably damaging Het
Cnnm1 T A 19: 43,491,886 S883T probably benign Het
Cntn6 T C 6: 104,838,820 W721R probably damaging Het
Defb43 A G 14: 63,017,832 K38R probably damaging Het
Eif2a T C 3: 58,555,601 S522P probably benign Het
Erap1 T G 13: 74,663,518 S332R probably benign Het
Foxa3 C A 7: 19,014,865 R112L probably damaging Het
Foxf1 T A 8: 121,084,976 M193K possibly damaging Het
Gbp11 T C 5: 105,328,424 Y273C possibly damaging Het
Gli2 T A 1: 118,836,291 T1377S probably benign Het
Gm10271 T A 10: 116,972,574 L12F probably damaging Het
Gm13023 T G 4: 143,793,693 L169R probably benign Het
Grm5 G A 7: 88,074,383 G627D probably damaging Het
Gtf3c4 A G 2: 28,834,836 S295P probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Iqch T A 9: 63,421,918 M1045L probably benign Het
Kcnt2 T C 1: 140,484,193 S455P possibly damaging Het
Kif26b G A 1: 178,914,946 G869E probably damaging Het
Kit A G 5: 75,639,132 N508S probably benign Het
Lgals8 C T 13: 12,454,896 V61M probably damaging Het
Lztr1 T C 16: 17,521,479 V392A possibly damaging Het
Mad1l1 T A 5: 140,105,541 M524L probably benign Het
Mob3b T C 4: 34,986,101 N146D probably benign Het
Muc16 T C 9: 18,656,040 T1728A unknown Het
Nlgn2 T C 11: 69,828,029 H278R probably damaging Het
Plce1 A G 19: 38,716,979 M943V probably benign Het
Proser2 A G 2: 6,101,204 L183P probably benign Het
Prss36 T C 7: 127,944,816 I128V probably benign Het
Rabggta C T 14: 55,719,288 V320I probably benign Het
Sepsecs A G 5: 52,666,002 V125A probably benign Het
Sik3 C T 9: 46,211,918 P1005L probably benign Het
Slc22a20 A T 19: 5,972,981 I378N possibly damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Tap1 T C 17: 34,193,303 V494A probably benign Het
Tg A G 15: 66,698,461 D1394G probably benign Het
Tgfbr3 T C 5: 107,142,495 T315A possibly damaging Het
Tmc2 A G 2: 130,243,129 T559A probably damaging Het
Tph1 A G 7: 46,662,105 I71T probably benign Het
Trib3 A T 2: 152,343,042 C96S probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trim56 A G 5: 137,112,778 V628A probably damaging Het
Ttc6 A G 12: 57,729,424 Y1718C probably damaging Het
Tuft1 T C 3: 94,622,138 Q244R probably benign Het
Unc13b A G 4: 43,240,321 T793A probably benign Het
Vmn1r39 A G 6: 66,804,596 I246T possibly damaging Het
Xpo1 T C 11: 23,282,646 S389P probably benign Het
Zdbf2 T C 1: 63,308,009 F1849S possibly damaging Het
Other mutations in Nlgn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Nlgn3 APN X 101320092 missense probably benign 0.28
IGL01327:Nlgn3 APN X 101318622 missense probably benign 0.08
IGL01414:Nlgn3 APN X 101302260 missense probably benign 0.00
R1296:Nlgn3 UTSW X 101308916 splice site probably benign
R1794:Nlgn3 UTSW X 101320033 missense probably benign 0.30
R5144:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5145:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5146:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R8677:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8678:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8684:Nlgn3 UTSW X 101319819 nonsense probably null
R8696:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8905:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R8906:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R9231:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R9234:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R9235:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R9236:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
R9253:Nlgn3 UTSW X 101308784 missense probably damaging 1.00
Z1176:Nlgn3 UTSW X 101317982 missense probably benign 0.30
Z1176:Nlgn3 UTSW X 101319877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTCAACTCCGGGCCTAG -3'
(R):5'- TAGTTATTAACACCAGCGAGAGATC -3'

Sequencing Primer
(F):5'- TAGCAGCCCCACGAGTC -3'
(R):5'- TAGGACTACCTAAATTGACTTCCCTG -3'
Posted On 2022-02-07