Incidental Mutation 'R0760:Hspa4l'
ID 70036
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 038940-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R0760 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 40739155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 681 (L681*)
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably null
Transcript: ENSMUST00000077083
AA Change: L681*
SMART Domains Protein: ENSMUSP00000076336
Gene: ENSMUSG00000025757
AA Change: L681*

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108086
AA Change: L660*
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757
AA Change: L660*

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204174
Predicted Effect probably null
Transcript: ENSMUST00000204702
AA Change: L681*
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757
AA Change: L681*

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,324,661 (GRCm39) V120A possibly damaging Het
Adamts2 T C 11: 50,666,153 (GRCm39) V383A probably damaging Het
Alcam C T 16: 52,116,035 (GRCm39) V180M probably benign Het
Catip A G 1: 74,402,118 (GRCm39) probably benign Het
Ccm2l A C 2: 152,914,104 (GRCm39) N298T probably damaging Het
Ccni A G 5: 93,331,188 (GRCm39) V261A possibly damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cyb5d1 A G 11: 69,285,999 (GRCm39) F41L probably benign Het
Fbxw8 A G 5: 118,203,966 (GRCm39) probably null Het
Garin2 A G 12: 78,761,927 (GRCm39) D197G probably damaging Het
Gpaa1 T C 15: 76,216,119 (GRCm39) I33T probably benign Het
Grip1 T A 10: 119,853,983 (GRCm39) S512T probably damaging Het
Gtpbp1 G A 15: 79,603,356 (GRCm39) G140E probably damaging Het
Hspg2 A G 4: 137,239,660 (GRCm39) T456A probably damaging Het
Igkv3-1 A T 6: 70,681,119 (GRCm39) D106V probably damaging Het
Inhbc C T 10: 127,193,237 (GRCm39) G260S probably damaging Het
Itga2 C T 13: 114,996,168 (GRCm39) V708I possibly damaging Het
Kif5c T C 2: 49,578,765 (GRCm39) I131T probably damaging Het
Kmt2c A G 5: 25,558,315 (GRCm39) Y1133H possibly damaging Het
Lama2 A G 10: 26,920,429 (GRCm39) probably null Het
N4bp1 A G 8: 87,573,540 (GRCm39) Y744H probably damaging Het
Or14j7 C T 17: 38,235,005 (GRCm39) Q183* probably null Het
Or1n2 A G 2: 36,797,233 (GRCm39) S92G probably benign Het
Ovol2 A G 2: 144,173,679 (GRCm39) probably null Het
Pappa2 C A 1: 158,544,531 (GRCm39) probably null Het
Pcdh10 G A 3: 45,335,005 (GRCm39) E440K probably benign Het
Pcsk4 A G 10: 80,161,775 (GRCm39) probably benign Het
Plcl2 A G 17: 50,915,802 (GRCm39) N937S possibly damaging Het
Ppp6r1 A G 7: 4,642,722 (GRCm39) F541L probably benign Het
Rad54l2 A G 9: 106,596,805 (GRCm39) probably null Het
Ranbp2 C T 10: 58,312,613 (GRCm39) P1111L possibly damaging Het
Rasal3 A G 17: 32,611,146 (GRCm39) F929S probably benign Het
Rnf111 A G 9: 70,336,960 (GRCm39) V909A probably damaging Het
Rnf168 A G 16: 32,117,204 (GRCm39) probably null Het
Slc2a5 T C 4: 150,224,124 (GRCm39) L244P probably benign Het
Snta1 T A 2: 154,222,860 (GRCm39) I288F probably damaging Het
Sv2a G A 3: 96,095,498 (GRCm39) C297Y probably damaging Het
Trim44 C T 2: 102,230,905 (GRCm39) probably benign Het
Uggt1 A T 1: 36,200,805 (GRCm39) I1164N possibly damaging Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R4994:Hspa4l UTSW 3 40,700,081 (GRCm39) utr 5 prime probably benign
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGCACTGTCTACGAAAAGTTCATCAC -3'
(R):5'- TGCGAAAGACAATAAGGACCGTTCTAC -3'

Sequencing Primer
(F):5'- CACCTATGTGGAGATGACTCTCAG -3'
(R):5'- gtgtagcccctgctgtc -3'
Posted On 2013-09-30