Incidental Mutation 'R0760:Pcdh10'
ID70037
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 038940-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0760 (G1)
Quality Score195
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45380570 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 440 (E440K)
Ref Sequence ENSEMBL: ENSMUSP00000141529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably benign
Transcript: ENSMUST00000166126
AA Change: E440K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: E440K

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170695
AA Change: E440K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: E440K

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171554
AA Change: E440K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: E440K

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect probably benign
Transcript: ENSMUST00000193252
AA Change: E440K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: E440K

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.0978 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,347,702 V120A possibly damaging Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Alcam C T 16: 52,295,672 V180M probably benign Het
Catip A G 1: 74,362,959 probably benign Het
Ccm2l A C 2: 153,072,184 N298T probably damaging Het
Ccni A G 5: 93,183,329 V261A possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5d1 A G 11: 69,395,173 F41L probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fbxw8 A G 5: 118,065,901 probably null Het
Gpaa1 T C 15: 76,331,919 I33T probably benign Het
Grip1 T A 10: 120,018,078 S512T probably damaging Het
Gtpbp1 G A 15: 79,719,155 G140E probably damaging Het
Hspa4l T A 3: 40,784,723 L681* probably null Het
Hspg2 A G 4: 137,512,349 T456A probably damaging Het
Igkv3-1 A T 6: 70,704,135 D106V probably damaging Het
Inhbc C T 10: 127,357,368 G260S probably damaging Het
Itga2 C T 13: 114,859,632 V708I possibly damaging Het
Kif5c T C 2: 49,688,753 I131T probably damaging Het
Kmt2c A G 5: 25,353,317 Y1133H possibly damaging Het
Lama2 A G 10: 27,044,433 probably null Het
N4bp1 A G 8: 86,846,912 Y744H probably damaging Het
Olfr128 C T 17: 37,924,114 Q183* probably null Het
Olfr354 A G 2: 36,907,221 S92G probably benign Het
Ovol2 A G 2: 144,331,759 probably null Het
Pappa2 C A 1: 158,716,961 probably null Het
Pcsk4 A G 10: 80,325,941 probably benign Het
Plcl2 A G 17: 50,608,774 N937S possibly damaging Het
Ppp6r1 A G 7: 4,639,723 F541L probably benign Het
Rad54l2 A G 9: 106,719,606 probably null Het
Ranbp2 C T 10: 58,476,791 P1111L possibly damaging Het
Rasal3 A G 17: 32,392,172 F929S probably benign Het
Rnf111 A G 9: 70,429,678 V909A probably damaging Het
Rnf168 A G 16: 32,298,386 probably null Het
Slc2a5 T C 4: 150,139,667 L244P probably benign Het
Snta1 T A 2: 154,380,940 I288F probably damaging Het
Sv2a G A 3: 96,188,182 C297Y probably damaging Het
Trim44 C T 2: 102,400,560 probably benign Het
Uggt1 A T 1: 36,161,724 I1164N possibly damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5784:Pcdh10 UTSW 3 45380640 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45381744 missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45381498 missense probably damaging 0.99
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTGCTGGATGCCAACGACAAC -3'
(R):5'- TCGAAGGATCTCAGGGCGTACAAG -3'

Sequencing Primer
(F):5'- AGATCAGCTTCAGCACAGTG -3'
(R):5'- AGGTGAAGACACTCATTCCTTGG -3'
Posted On2013-09-30