Incidental Mutation 'R9233:Slfn8'
ID 700373
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9233 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 82892984-82911636 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 82894422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Arginine at position 739 (I739R)
Ref Sequence ENSEMBL: ENSMUSP00000040060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect probably damaging
Transcript: ENSMUST00000038141
AA Change: I739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: I739R

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092838
AA Change: I739R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: I739R

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130822
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131883
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G T 11: 110,082,496 (GRCm39) T1159K probably benign Het
Acap1 A G 11: 69,775,484 (GRCm39) V479A probably benign Het
Actl11 A G 9: 107,807,900 (GRCm39) E741G possibly damaging Het
Anp32b A T 4: 46,463,909 (GRCm39) I103F probably damaging Het
Ap4m1 C T 5: 138,176,653 (GRCm39) R418* probably null Het
Asic3 G A 5: 24,618,837 (GRCm39) R43H probably damaging Het
Bsn A G 9: 107,994,289 (GRCm39) V662A probably benign Het
Cacna1a C T 8: 85,271,283 (GRCm39) R479C probably damaging Het
Chchd3 A T 6: 32,780,845 (GRCm39) C214S probably damaging Het
Cspg4b A T 13: 113,502,754 (GRCm39) Y100F Het
Dock9 T A 14: 121,820,781 (GRCm39) T1538S probably benign Het
Dyrk1a A G 16: 94,466,913 (GRCm39) M156V probably benign Het
Dzip1 T C 14: 119,124,635 (GRCm39) Q546R probably benign Het
Eef2 T C 10: 81,014,668 (GRCm39) V185A probably benign Het
Etv4 A C 11: 101,662,532 (GRCm39) V314G probably damaging Het
F5 T A 1: 164,047,020 (GRCm39) I2160N probably damaging Het
Fbp2 A T 13: 62,989,622 (GRCm39) V228E possibly damaging Het
Fcgbpl1 A G 7: 27,839,519 (GRCm39) Y444C possibly damaging Het
Fhip2a T A 19: 57,369,098 (GRCm39) F360L probably damaging Het
Gcc1 A G 6: 28,418,710 (GRCm39) L541P probably damaging Het
Gemin4 A G 11: 76,103,942 (GRCm39) I273T possibly damaging Het
Gm32742 T C 9: 51,056,387 (GRCm39) K1193E possibly damaging Het
Gmps C T 3: 63,924,133 (GRCm39) P687L probably damaging Het
Gpr162 A G 6: 124,836,014 (GRCm39) L462P possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hspa12b T C 2: 130,976,036 (GRCm39) Y13H probably damaging Het
Kcnh8 A C 17: 53,285,168 (GRCm39) E1046A probably damaging Het
Kcnk12 T A 17: 88,053,538 (GRCm39) T375S probably benign Het
Kdm4a A G 4: 118,004,193 (GRCm39) probably null Het
Klhl5 G T 5: 65,300,673 (GRCm39) V219L possibly damaging Het
Kpna1 A T 16: 35,853,793 (GRCm39) E474D probably damaging Het
Lama5 A T 2: 179,840,502 (GRCm39) Y632* probably null Het
Lias A G 5: 65,551,331 (GRCm39) N88S probably benign Het
Mei1 C T 15: 81,973,752 (GRCm39) R80C Het
Mical2 T G 7: 111,981,399 (GRCm39) S458A probably benign Het
Mrps33 A G 6: 39,782,447 (GRCm39) S25P probably benign Het
Mttp T A 3: 137,822,280 (GRCm39) D169V probably damaging Het
Npdc1 A G 2: 25,296,329 (GRCm39) E72G probably damaging Het
Nsrp1 G A 11: 76,937,036 (GRCm39) R387W probably benign Het
Pcnx4 A G 12: 72,603,587 (GRCm39) T503A possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pigu C T 2: 155,178,610 (GRCm39) V83I possibly damaging Het
Ppcs G A 4: 119,279,397 (GRCm39) R52* probably null Het
Rbm33 A G 5: 28,544,239 (GRCm39) E165G probably benign Het
Rnf5 A T 17: 34,822,326 (GRCm39) V41E possibly damaging Het
Ror2 T C 13: 53,265,590 (GRCm39) T501A probably benign Het
Rps17 T G 7: 80,993,497 (GRCm39) M105L probably benign Het
Ryr2 A T 13: 11,610,772 (GRCm39) M4018K possibly damaging Het
Scarf1 A G 11: 75,416,720 (GRCm39) M721V probably benign Het
Scgb1b30 A G 7: 33,799,184 (GRCm39) T39A probably damaging Het
Selenoo T C 15: 88,984,044 (GRCm39) V620A probably damaging Het
Smc6 A G 12: 11,359,291 (GRCm39) T972A probably benign Het
Spred1 G A 2: 117,002,644 (GRCm39) R221H unknown Het
Stag1 T A 9: 100,812,024 (GRCm39) M834K probably benign Het
Taf1a T C 1: 183,181,878 (GRCm39) I177T possibly damaging Het
Tcam1 G A 11: 106,175,018 (GRCm39) D158N probably benign Het
Tcirg1 G T 19: 3,952,543 (GRCm39) T275K probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tor1b A C 2: 30,844,015 (GRCm39) I151L probably benign Het
Trappc12 T A 12: 28,772,414 (GRCm39) Q471L possibly damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Ugt2a2 G A 5: 87,613,272 (GRCm39) P288S probably damaging Het
Vmn1r157 T C 7: 22,461,381 (GRCm39) L87P probably damaging Het
Vmn1r188 A G 13: 22,272,399 (GRCm39) R118G probably benign Het
Vps13d G A 4: 144,879,344 (GRCm39) T1493I Het
Xrra1 T G 7: 99,516,574 (GRCm39) M6R probably benign Het
Zfp142 T C 1: 74,610,288 (GRCm39) E1169G probably benign Het
Zfp738 G T 13: 67,819,017 (GRCm39) R325S possibly damaging Het
Zmym4 A G 4: 126,776,310 (GRCm39) M1209T probably damaging Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 82,904,310 (GRCm39) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 82,895,462 (GRCm39) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 82,895,059 (GRCm39) nonsense probably null
IGL01875:Slfn8 APN 11 82,894,905 (GRCm39) missense probably benign 0.30
IGL01896:Slfn8 APN 11 82,894,522 (GRCm39) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 82,894,231 (GRCm39) nonsense probably null
IGL02111:Slfn8 APN 11 82,895,324 (GRCm39) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 82,894,291 (GRCm39) nonsense probably null
IGL02165:Slfn8 APN 11 82,908,022 (GRCm39) missense probably benign 0.00
IGL02645:Slfn8 APN 11 82,894,380 (GRCm39) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 82,894,517 (GRCm39) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 82,907,934 (GRCm39) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 82,908,333 (GRCm39) missense probably benign 0.01
IGL03243:Slfn8 APN 11 82,894,533 (GRCm39) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 82,904,294 (GRCm39) missense probably damaging 0.99
seven_dwarfs UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
vanwinkle UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R0295:Slfn8 UTSW 11 82,894,169 (GRCm39) nonsense probably null
R0368:Slfn8 UTSW 11 82,907,958 (GRCm39) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 82,895,382 (GRCm39) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R0894:Slfn8 UTSW 11 82,894,407 (GRCm39) missense probably benign 0.07
R1006:Slfn8 UTSW 11 82,894,337 (GRCm39) missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 82,907,571 (GRCm39) missense probably benign 0.19
R1187:Slfn8 UTSW 11 82,894,314 (GRCm39) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 82,894,006 (GRCm39) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 82,907,712 (GRCm39) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 82,894,447 (GRCm39) nonsense probably null
R2005:Slfn8 UTSW 11 82,894,976 (GRCm39) missense probably damaging 1.00
R2363:Slfn8 UTSW 11 82,894,920 (GRCm39) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 82,908,280 (GRCm39) missense probably benign 0.13
R3890:Slfn8 UTSW 11 82,895,270 (GRCm39) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 82,907,819 (GRCm39) nonsense probably null
R4559:Slfn8 UTSW 11 82,895,570 (GRCm39) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 82,908,332 (GRCm39) missense probably benign 0.10
R4767:Slfn8 UTSW 11 82,894,023 (GRCm39) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R4859:Slfn8 UTSW 11 82,908,540 (GRCm39) start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 82,907,704 (GRCm39) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 82,894,111 (GRCm39) missense probably benign 0.01
R5107:Slfn8 UTSW 11 82,907,976 (GRCm39) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R5165:Slfn8 UTSW 11 82,907,953 (GRCm39) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 82,904,214 (GRCm39) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 82,908,550 (GRCm39) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 82,894,910 (GRCm39) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 82,895,042 (GRCm39) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 82,895,547 (GRCm39) missense probably benign 0.01
R5782:Slfn8 UTSW 11 82,907,867 (GRCm39) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 82,907,562 (GRCm39) missense probably benign 0.01
R5886:Slfn8 UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
R5933:Slfn8 UTSW 11 82,894,161 (GRCm39) missense probably benign 0.00
R6151:Slfn8 UTSW 11 82,908,147 (GRCm39) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 82,894,690 (GRCm39) makesense probably null
R6191:Slfn8 UTSW 11 82,907,626 (GRCm39) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 82,894,881 (GRCm39) splice site probably null
R6925:Slfn8 UTSW 11 82,904,243 (GRCm39) nonsense probably null
R7065:Slfn8 UTSW 11 82,907,794 (GRCm39) missense probably benign 0.01
R7380:Slfn8 UTSW 11 82,894,566 (GRCm39) missense not run
R7414:Slfn8 UTSW 11 82,907,618 (GRCm39) nonsense probably null
R7819:Slfn8 UTSW 11 82,895,081 (GRCm39) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 82,895,441 (GRCm39) missense possibly damaging 0.80
R8517:Slfn8 UTSW 11 82,894,968 (GRCm39) missense possibly damaging 0.68
R8804:Slfn8 UTSW 11 82,907,639 (GRCm39) missense possibly damaging 0.94
R8814:Slfn8 UTSW 11 82,907,505 (GRCm39) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 82,907,902 (GRCm39) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 82,908,532 (GRCm39) missense probably benign
R9678:Slfn8 UTSW 11 82,907,723 (GRCm39) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 82,894,267 (GRCm39) missense probably benign 0.00
R9764:Slfn8 UTSW 11 82,907,838 (GRCm39) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 82,907,754 (GRCm39) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 82,894,359 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTTGGAGAGAATAGCCTTTACG -3'
(R):5'- CGCACTGAGGATGGAAACTG -3'

Sequencing Primer
(F):5'- GAGAATAGCCTTTACGCAAGAAATC -3'
(R):5'- CACTGAGGATGGAAACTGGTATG -3'
Posted On 2022-02-07