Incidental Mutation 'R9233:Ror2'
ID 700382
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Name receptor tyrosine kinase-like orphan receptor 2
Synonyms Ntrkr2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9233 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 53109312-53286124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53111554 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 501 (T501A)
Ref Sequence ENSEMBL: ENSMUSP00000021918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000021918
AA Change: T501A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: T501A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130235
AA Change: T489A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: T489A

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,140,094 Y444C possibly damaging Het
Abca6 G T 11: 110,191,670 T1159K probably benign Het
Acap1 A G 11: 69,884,658 V479A probably benign Het
Actl11 A G 9: 107,930,701 E741G possibly damaging Het
Anp32b A T 4: 46,463,909 I103F probably damaging Het
Ap4m1 C T 5: 138,178,391 R418* probably null Het
Asic3 G A 5: 24,413,839 R43H probably damaging Het
BC067074 A T 13: 113,366,220 Y100F Het
Bsn A G 9: 108,117,090 V662A probably benign Het
Cacna1a C T 8: 84,544,654 R479C probably damaging Het
Chchd3 A T 6: 32,803,910 C214S probably damaging Het
Dock9 T A 14: 121,583,369 T1538S probably benign Het
Dyrk1a A G 16: 94,666,054 M156V probably benign Het
Dzip1 T C 14: 118,887,223 Q546R probably benign Het
Eef2 T C 10: 81,178,834 V185A probably benign Het
Etv4 A C 11: 101,771,706 V314G probably damaging Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fam160b1 T A 19: 57,380,666 F360L probably damaging Het
Fbp2 A T 13: 62,841,808 V228E possibly damaging Het
Gcc1 A G 6: 28,418,711 L541P probably damaging Het
Gemin4 A G 11: 76,213,116 I273T possibly damaging Het
Gm32742 T C 9: 51,145,087 K1193E possibly damaging Het
Gmps C T 3: 64,016,712 P687L probably damaging Het
Gpr162 A G 6: 124,859,051 L462P possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspa12b T C 2: 131,134,116 Y13H probably damaging Het
Kcnh8 A C 17: 52,978,140 E1046A probably damaging Het
Kcnk12 T A 17: 87,746,110 T375S probably benign Het
Kdm4a A G 4: 118,146,996 probably null Het
Klhl5 G T 5: 65,143,330 V219L possibly damaging Het
Kpna1 A T 16: 36,033,423 E474D probably damaging Het
Lama5 A T 2: 180,198,709 Y632* probably null Het
Lias A G 5: 65,393,988 N88S probably benign Het
Mei1 C T 15: 82,089,551 R80C Het
Micalcl T G 7: 112,382,192 S458A probably benign Het
Mrps33 A G 6: 39,805,513 S25P probably benign Het
Mttp T A 3: 138,116,519 D169V probably damaging Het
Npdc1 A G 2: 25,406,317 E72G probably damaging Het
Nsrp1 G A 11: 77,046,210 R387W probably benign Het
Pcnx4 A G 12: 72,556,813 T503A possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigu C T 2: 155,336,690 V83I possibly damaging Het
Ppcs G A 4: 119,422,200 R52* probably null Het
Rbm33 A G 5: 28,339,241 E165G probably benign Het
Rnf5 A T 17: 34,603,352 V41E possibly damaging Het
Rps17 T G 7: 81,343,749 M105L probably benign Het
Ryr2 A T 13: 11,595,886 M4018K possibly damaging Het
Scarf1 A G 11: 75,525,894 M721V probably benign Het
Scgb1b30 A G 7: 34,099,759 T39A probably damaging Het
Selenoo T C 15: 89,099,841 V620A probably damaging Het
Slfn8 A C 11: 83,003,596 I739R probably damaging Het
Smc6 A G 12: 11,309,290 T972A probably benign Het
Spred1 G A 2: 117,172,163 R221H unknown Het
Stag1 T A 9: 100,929,971 M834K probably benign Het
Taf1a T C 1: 183,400,724 I177T possibly damaging Het
Tcam1 G A 11: 106,284,192 D158N probably benign Het
Tcirg1 G T 19: 3,902,543 T275K probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tor1b A C 2: 30,954,003 I151L probably benign Het
Trappc12 T A 12: 28,722,415 Q471L possibly damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Ugt2a2 G A 5: 87,465,413 P288S probably damaging Het
Vmn1r157 T C 7: 22,761,956 L87P probably damaging Het
Vmn1r188 A G 13: 22,088,229 R118G probably benign Het
Vps13d G A 4: 145,152,774 T1493I Het
Xrra1 T G 7: 99,867,367 M6R probably benign Het
Zfp142 T C 1: 74,571,129 E1169G probably benign Het
Zfp738 G T 13: 67,670,898 R325S possibly damaging Het
Zmym4 A G 4: 126,882,517 M1209T probably damaging Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
lavage UTSW 13 53118982 missense probably damaging 1.00
tendrils UTSW 13 53111451 missense probably damaging 0.96
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2405:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
R8031:Ror2 UTSW 13 53113157 missense probably damaging 1.00
R8479:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R8684:Ror2 UTSW 13 53110266 missense possibly damaging 0.90
R8834:Ror2 UTSW 13 53110302 small deletion probably benign
R8948:Ror2 UTSW 13 53131996 missense possibly damaging 0.67
R9234:Ror2 UTSW 13 53111338 missense probably damaging 1.00
R9573:Ror2 UTSW 13 53111431 missense not run
Predicted Primers PCR Primer
(F):5'- GAACAGTAGCTGAAGATCATGC -3'
(R):5'- GTATTAAAAGGGCTGCCAGGC -3'

Sequencing Primer
(F):5'- AAGATCATGCTCAAGGGTTGGTCC -3'
(R):5'- ACAGGACCAGCAAGGCCTTG -3'
Posted On 2022-02-07