Incidental Mutation 'R9233:Dock9'
ID 700387
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9233 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121583369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1538 (T1538S)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040700
AA Change: T1537S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: T1537S

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: T1508S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: T1508S

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: T1538S

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212376
AA Change: T1528S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,140,094 Y444C possibly damaging Het
Abca6 G T 11: 110,191,670 T1159K probably benign Het
Acap1 A G 11: 69,884,658 V479A probably benign Het
Actl11 A G 9: 107,930,701 E741G possibly damaging Het
Anp32b A T 4: 46,463,909 I103F probably damaging Het
Ap4m1 C T 5: 138,178,391 R418* probably null Het
Asic3 G A 5: 24,413,839 R43H probably damaging Het
BC067074 A T 13: 113,366,220 Y100F Het
Bsn A G 9: 108,117,090 V662A probably benign Het
Cacna1a C T 8: 84,544,654 R479C probably damaging Het
Chchd3 A T 6: 32,803,910 C214S probably damaging Het
Dyrk1a A G 16: 94,666,054 M156V probably benign Het
Dzip1 T C 14: 118,887,223 Q546R probably benign Het
Eef2 T C 10: 81,178,834 V185A probably benign Het
Etv4 A C 11: 101,771,706 V314G probably damaging Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fam160b1 T A 19: 57,380,666 F360L probably damaging Het
Fbp2 A T 13: 62,841,808 V228E possibly damaging Het
Gcc1 A G 6: 28,418,711 L541P probably damaging Het
Gemin4 A G 11: 76,213,116 I273T possibly damaging Het
Gm32742 T C 9: 51,145,087 K1193E possibly damaging Het
Gmps C T 3: 64,016,712 P687L probably damaging Het
Gpr162 A G 6: 124,859,051 L462P possibly damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hspa12b T C 2: 131,134,116 Y13H probably damaging Het
Kcnh8 A C 17: 52,978,140 E1046A probably damaging Het
Kcnk12 T A 17: 87,746,110 T375S probably benign Het
Kdm4a A G 4: 118,146,996 probably null Het
Klhl5 G T 5: 65,143,330 V219L possibly damaging Het
Kpna1 A T 16: 36,033,423 E474D probably damaging Het
Lama5 A T 2: 180,198,709 Y632* probably null Het
Lias A G 5: 65,393,988 N88S probably benign Het
Mei1 C T 15: 82,089,551 R80C Het
Micalcl T G 7: 112,382,192 S458A probably benign Het
Mrps33 A G 6: 39,805,513 S25P probably benign Het
Mttp T A 3: 138,116,519 D169V probably damaging Het
Npdc1 A G 2: 25,406,317 E72G probably damaging Het
Nsrp1 G A 11: 77,046,210 R387W probably benign Het
Pcnx4 A G 12: 72,556,813 T503A possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pigu C T 2: 155,336,690 V83I possibly damaging Het
Ppcs G A 4: 119,422,200 R52* probably null Het
Rbm33 A G 5: 28,339,241 E165G probably benign Het
Rnf5 A T 17: 34,603,352 V41E possibly damaging Het
Ror2 T C 13: 53,111,554 T501A probably benign Het
Rps17 T G 7: 81,343,749 M105L probably benign Het
Ryr2 A T 13: 11,595,886 M4018K possibly damaging Het
Scarf1 A G 11: 75,525,894 M721V probably benign Het
Scgb1b30 A G 7: 34,099,759 T39A probably damaging Het
Selenoo T C 15: 89,099,841 V620A probably damaging Het
Slfn8 A C 11: 83,003,596 I739R probably damaging Het
Smc6 A G 12: 11,309,290 T972A probably benign Het
Spred1 G A 2: 117,172,163 R221H unknown Het
Stag1 T A 9: 100,929,971 M834K probably benign Het
Taf1a T C 1: 183,400,724 I177T possibly damaging Het
Tcam1 G A 11: 106,284,192 D158N probably benign Het
Tcirg1 G T 19: 3,902,543 T275K probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tor1b A C 2: 30,954,003 I151L probably benign Het
Trappc12 T A 12: 28,722,415 Q471L possibly damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Ugt2a2 G A 5: 87,465,413 P288S probably damaging Het
Vmn1r157 T C 7: 22,761,956 L87P probably damaging Het
Vmn1r188 A G 13: 22,088,229 R118G probably benign Het
Vps13d G A 4: 145,152,774 T1493I Het
Xrra1 T G 7: 99,867,367 M6R probably benign Het
Zfp142 T C 1: 74,571,129 E1169G probably benign Het
Zfp738 G T 13: 67,670,898 R325S possibly damaging Het
Zmym4 A G 4: 126,882,517 M1209T probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGATGAGACATGCCAGGCC -3'
(R):5'- CAGTCTCGCTGGTGATTACG -3'

Sequencing Primer
(F):5'- CAGGCCAGGCTCTGTAAGAAC -3'
(R):5'- AGGAGCACTGACCTCTCTG -3'
Posted On 2022-02-07