Incidental Mutation 'R9233:Dock9'
ID 700387
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9233 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121820781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 1538 (T1538S)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000040700
AA Change: T1537S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: T1537S

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: T1508S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: T1508S

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: T1538S

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212376
AA Change: T1528S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G T 11: 110,082,496 (GRCm39) T1159K probably benign Het
Acap1 A G 11: 69,775,484 (GRCm39) V479A probably benign Het
Actl11 A G 9: 107,807,900 (GRCm39) E741G possibly damaging Het
Anp32b A T 4: 46,463,909 (GRCm39) I103F probably damaging Het
Ap4m1 C T 5: 138,176,653 (GRCm39) R418* probably null Het
Asic3 G A 5: 24,618,837 (GRCm39) R43H probably damaging Het
Bsn A G 9: 107,994,289 (GRCm39) V662A probably benign Het
Cacna1a C T 8: 85,271,283 (GRCm39) R479C probably damaging Het
Chchd3 A T 6: 32,780,845 (GRCm39) C214S probably damaging Het
Cspg4b A T 13: 113,502,754 (GRCm39) Y100F Het
Dyrk1a A G 16: 94,466,913 (GRCm39) M156V probably benign Het
Dzip1 T C 14: 119,124,635 (GRCm39) Q546R probably benign Het
Eef2 T C 10: 81,014,668 (GRCm39) V185A probably benign Het
Etv4 A C 11: 101,662,532 (GRCm39) V314G probably damaging Het
F5 T A 1: 164,047,020 (GRCm39) I2160N probably damaging Het
Fbp2 A T 13: 62,989,622 (GRCm39) V228E possibly damaging Het
Fcgbpl1 A G 7: 27,839,519 (GRCm39) Y444C possibly damaging Het
Fhip2a T A 19: 57,369,098 (GRCm39) F360L probably damaging Het
Gcc1 A G 6: 28,418,710 (GRCm39) L541P probably damaging Het
Gemin4 A G 11: 76,103,942 (GRCm39) I273T possibly damaging Het
Gm32742 T C 9: 51,056,387 (GRCm39) K1193E possibly damaging Het
Gmps C T 3: 63,924,133 (GRCm39) P687L probably damaging Het
Gpr162 A G 6: 124,836,014 (GRCm39) L462P possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hspa12b T C 2: 130,976,036 (GRCm39) Y13H probably damaging Het
Kcnh8 A C 17: 53,285,168 (GRCm39) E1046A probably damaging Het
Kcnk12 T A 17: 88,053,538 (GRCm39) T375S probably benign Het
Kdm4a A G 4: 118,004,193 (GRCm39) probably null Het
Klhl5 G T 5: 65,300,673 (GRCm39) V219L possibly damaging Het
Kpna1 A T 16: 35,853,793 (GRCm39) E474D probably damaging Het
Lama5 A T 2: 179,840,502 (GRCm39) Y632* probably null Het
Lias A G 5: 65,551,331 (GRCm39) N88S probably benign Het
Mei1 C T 15: 81,973,752 (GRCm39) R80C Het
Mical2 T G 7: 111,981,399 (GRCm39) S458A probably benign Het
Mrps33 A G 6: 39,782,447 (GRCm39) S25P probably benign Het
Mttp T A 3: 137,822,280 (GRCm39) D169V probably damaging Het
Npdc1 A G 2: 25,296,329 (GRCm39) E72G probably damaging Het
Nsrp1 G A 11: 76,937,036 (GRCm39) R387W probably benign Het
Pcnx4 A G 12: 72,603,587 (GRCm39) T503A possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pigu C T 2: 155,178,610 (GRCm39) V83I possibly damaging Het
Ppcs G A 4: 119,279,397 (GRCm39) R52* probably null Het
Rbm33 A G 5: 28,544,239 (GRCm39) E165G probably benign Het
Rnf5 A T 17: 34,822,326 (GRCm39) V41E possibly damaging Het
Ror2 T C 13: 53,265,590 (GRCm39) T501A probably benign Het
Rps17 T G 7: 80,993,497 (GRCm39) M105L probably benign Het
Ryr2 A T 13: 11,610,772 (GRCm39) M4018K possibly damaging Het
Scarf1 A G 11: 75,416,720 (GRCm39) M721V probably benign Het
Scgb1b30 A G 7: 33,799,184 (GRCm39) T39A probably damaging Het
Selenoo T C 15: 88,984,044 (GRCm39) V620A probably damaging Het
Slfn8 A C 11: 82,894,422 (GRCm39) I739R probably damaging Het
Smc6 A G 12: 11,359,291 (GRCm39) T972A probably benign Het
Spred1 G A 2: 117,002,644 (GRCm39) R221H unknown Het
Stag1 T A 9: 100,812,024 (GRCm39) M834K probably benign Het
Taf1a T C 1: 183,181,878 (GRCm39) I177T possibly damaging Het
Tcam1 G A 11: 106,175,018 (GRCm39) D158N probably benign Het
Tcirg1 G T 19: 3,952,543 (GRCm39) T275K probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tor1b A C 2: 30,844,015 (GRCm39) I151L probably benign Het
Trappc12 T A 12: 28,772,414 (GRCm39) Q471L possibly damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Ugt2a2 G A 5: 87,613,272 (GRCm39) P288S probably damaging Het
Vmn1r157 T C 7: 22,461,381 (GRCm39) L87P probably damaging Het
Vmn1r188 A G 13: 22,272,399 (GRCm39) R118G probably benign Het
Vps13d G A 4: 144,879,344 (GRCm39) T1493I Het
Xrra1 T G 7: 99,516,574 (GRCm39) M6R probably benign Het
Zfp142 T C 1: 74,610,288 (GRCm39) E1169G probably benign Het
Zfp738 G T 13: 67,819,017 (GRCm39) R325S possibly damaging Het
Zmym4 A G 4: 126,776,310 (GRCm39) M1209T probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGATGAGACATGCCAGGCC -3'
(R):5'- CAGTCTCGCTGGTGATTACG -3'

Sequencing Primer
(F):5'- CAGGCCAGGCTCTGTAAGAAC -3'
(R):5'- AGGAGCACTGACCTCTCTG -3'
Posted On 2022-02-07