Incidental Mutation 'R9233:Fhip2a'
ID 700396
Institutional Source Beutler Lab
Gene Symbol Fhip2a
Ensembl Gene ENSMUSG00000033478
Gene Name FHF complex subunit HOOK interacting protein 2A
Synonyms Fam160b1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9233 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 57349355-57378026 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57369098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 360 (F360L)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
AlphaFold Q8CDM8
Predicted Effect probably damaging
Transcript: ENSMUST00000036407
AA Change: F360L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: F360L

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G T 11: 110,082,496 (GRCm39) T1159K probably benign Het
Acap1 A G 11: 69,775,484 (GRCm39) V479A probably benign Het
Actl11 A G 9: 107,807,900 (GRCm39) E741G possibly damaging Het
Anp32b A T 4: 46,463,909 (GRCm39) I103F probably damaging Het
Ap4m1 C T 5: 138,176,653 (GRCm39) R418* probably null Het
Asic3 G A 5: 24,618,837 (GRCm39) R43H probably damaging Het
Bsn A G 9: 107,994,289 (GRCm39) V662A probably benign Het
Cacna1a C T 8: 85,271,283 (GRCm39) R479C probably damaging Het
Chchd3 A T 6: 32,780,845 (GRCm39) C214S probably damaging Het
Cspg4b A T 13: 113,502,754 (GRCm39) Y100F Het
Dock9 T A 14: 121,820,781 (GRCm39) T1538S probably benign Het
Dyrk1a A G 16: 94,466,913 (GRCm39) M156V probably benign Het
Dzip1 T C 14: 119,124,635 (GRCm39) Q546R probably benign Het
Eef2 T C 10: 81,014,668 (GRCm39) V185A probably benign Het
Etv4 A C 11: 101,662,532 (GRCm39) V314G probably damaging Het
F5 T A 1: 164,047,020 (GRCm39) I2160N probably damaging Het
Fbp2 A T 13: 62,989,622 (GRCm39) V228E possibly damaging Het
Fcgbpl1 A G 7: 27,839,519 (GRCm39) Y444C possibly damaging Het
Gcc1 A G 6: 28,418,710 (GRCm39) L541P probably damaging Het
Gemin4 A G 11: 76,103,942 (GRCm39) I273T possibly damaging Het
Gm32742 T C 9: 51,056,387 (GRCm39) K1193E possibly damaging Het
Gmps C T 3: 63,924,133 (GRCm39) P687L probably damaging Het
Gpr162 A G 6: 124,836,014 (GRCm39) L462P possibly damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Hspa12b T C 2: 130,976,036 (GRCm39) Y13H probably damaging Het
Kcnh8 A C 17: 53,285,168 (GRCm39) E1046A probably damaging Het
Kcnk12 T A 17: 88,053,538 (GRCm39) T375S probably benign Het
Kdm4a A G 4: 118,004,193 (GRCm39) probably null Het
Klhl5 G T 5: 65,300,673 (GRCm39) V219L possibly damaging Het
Kpna1 A T 16: 35,853,793 (GRCm39) E474D probably damaging Het
Lama5 A T 2: 179,840,502 (GRCm39) Y632* probably null Het
Lias A G 5: 65,551,331 (GRCm39) N88S probably benign Het
Mei1 C T 15: 81,973,752 (GRCm39) R80C Het
Mical2 T G 7: 111,981,399 (GRCm39) S458A probably benign Het
Mrps33 A G 6: 39,782,447 (GRCm39) S25P probably benign Het
Mttp T A 3: 137,822,280 (GRCm39) D169V probably damaging Het
Npdc1 A G 2: 25,296,329 (GRCm39) E72G probably damaging Het
Nsrp1 G A 11: 76,937,036 (GRCm39) R387W probably benign Het
Pcnx4 A G 12: 72,603,587 (GRCm39) T503A possibly damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 (GRCm39) probably benign Het
Pigu C T 2: 155,178,610 (GRCm39) V83I possibly damaging Het
Ppcs G A 4: 119,279,397 (GRCm39) R52* probably null Het
Rbm33 A G 5: 28,544,239 (GRCm39) E165G probably benign Het
Rnf5 A T 17: 34,822,326 (GRCm39) V41E possibly damaging Het
Ror2 T C 13: 53,265,590 (GRCm39) T501A probably benign Het
Rps17 T G 7: 80,993,497 (GRCm39) M105L probably benign Het
Ryr2 A T 13: 11,610,772 (GRCm39) M4018K possibly damaging Het
Scarf1 A G 11: 75,416,720 (GRCm39) M721V probably benign Het
Scgb1b30 A G 7: 33,799,184 (GRCm39) T39A probably damaging Het
Selenoo T C 15: 88,984,044 (GRCm39) V620A probably damaging Het
Slfn8 A C 11: 82,894,422 (GRCm39) I739R probably damaging Het
Smc6 A G 12: 11,359,291 (GRCm39) T972A probably benign Het
Spred1 G A 2: 117,002,644 (GRCm39) R221H unknown Het
Stag1 T A 9: 100,812,024 (GRCm39) M834K probably benign Het
Taf1a T C 1: 183,181,878 (GRCm39) I177T possibly damaging Het
Tcam1 G A 11: 106,175,018 (GRCm39) D158N probably benign Het
Tcirg1 G T 19: 3,952,543 (GRCm39) T275K probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tor1b A C 2: 30,844,015 (GRCm39) I151L probably benign Het
Trappc12 T A 12: 28,772,414 (GRCm39) Q471L possibly damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Ugt2a2 G A 5: 87,613,272 (GRCm39) P288S probably damaging Het
Vmn1r157 T C 7: 22,461,381 (GRCm39) L87P probably damaging Het
Vmn1r188 A G 13: 22,272,399 (GRCm39) R118G probably benign Het
Vps13d G A 4: 144,879,344 (GRCm39) T1493I Het
Xrra1 T G 7: 99,516,574 (GRCm39) M6R probably benign Het
Zfp142 T C 1: 74,610,288 (GRCm39) E1169G probably benign Het
Zfp738 G T 13: 67,819,017 (GRCm39) R325S possibly damaging Het
Zmym4 A G 4: 126,776,310 (GRCm39) M1209T probably damaging Het
Other mutations in Fhip2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fhip2a APN 19 57,369,777 (GRCm39) missense probably benign 0.00
IGL02642:Fhip2a APN 19 57,373,782 (GRCm39) missense possibly damaging 0.55
IGL03152:Fhip2a APN 19 57,367,264 (GRCm39) missense probably damaging 0.99
fredericksburg UTSW 19 57,372,555 (GRCm39) nonsense probably null
williamsburg UTSW 19 57,372,697 (GRCm39) critical splice donor site probably null
R0001:Fhip2a UTSW 19 57,370,188 (GRCm39) missense probably benign 0.01
R0123:Fhip2a UTSW 19 57,369,839 (GRCm39) missense probably benign 0.00
R0368:Fhip2a UTSW 19 57,357,010 (GRCm39) missense possibly damaging 0.91
R0446:Fhip2a UTSW 19 57,369,839 (GRCm39) missense probably benign 0.00
R0508:Fhip2a UTSW 19 57,367,174 (GRCm39) missense probably benign 0.04
R0926:Fhip2a UTSW 19 57,369,522 (GRCm39) missense probably damaging 1.00
R1122:Fhip2a UTSW 19 57,370,733 (GRCm39) missense probably benign 0.00
R1344:Fhip2a UTSW 19 57,359,594 (GRCm39) missense possibly damaging 0.72
R1398:Fhip2a UTSW 19 57,361,358 (GRCm39) splice site probably benign
R1418:Fhip2a UTSW 19 57,359,594 (GRCm39) missense possibly damaging 0.72
R1506:Fhip2a UTSW 19 57,357,007 (GRCm39) missense probably benign 0.30
R1530:Fhip2a UTSW 19 57,374,737 (GRCm39) missense probably damaging 0.99
R1695:Fhip2a UTSW 19 57,367,603 (GRCm39) missense probably damaging 1.00
R1868:Fhip2a UTSW 19 57,374,737 (GRCm39) missense possibly damaging 0.75
R1974:Fhip2a UTSW 19 57,373,809 (GRCm39) missense probably damaging 0.99
R2004:Fhip2a UTSW 19 57,370,324 (GRCm39) missense probably benign
R2893:Fhip2a UTSW 19 57,372,601 (GRCm39) missense probably benign 0.01
R3011:Fhip2a UTSW 19 57,373,720 (GRCm39) missense probably damaging 1.00
R3963:Fhip2a UTSW 19 57,361,442 (GRCm39) missense possibly damaging 0.77
R4416:Fhip2a UTSW 19 57,373,829 (GRCm39) splice site probably null
R4613:Fhip2a UTSW 19 57,359,619 (GRCm39) missense probably damaging 0.99
R4735:Fhip2a UTSW 19 57,359,661 (GRCm39) missense probably damaging 1.00
R4893:Fhip2a UTSW 19 57,370,188 (GRCm39) missense probably benign 0.01
R4937:Fhip2a UTSW 19 57,367,069 (GRCm39) missense probably benign
R5049:Fhip2a UTSW 19 57,374,737 (GRCm39) missense possibly damaging 0.75
R5050:Fhip2a UTSW 19 57,371,602 (GRCm39) missense probably damaging 1.00
R5080:Fhip2a UTSW 19 57,361,713 (GRCm39) missense probably damaging 1.00
R5176:Fhip2a UTSW 19 57,359,613 (GRCm39) missense probably damaging 0.98
R5317:Fhip2a UTSW 19 57,370,141 (GRCm39) splice site probably null
R5347:Fhip2a UTSW 19 57,367,051 (GRCm39) missense probably benign
R5497:Fhip2a UTSW 19 57,369,583 (GRCm39) splice site probably null
R5969:Fhip2a UTSW 19 57,372,555 (GRCm39) nonsense probably null
R6418:Fhip2a UTSW 19 57,370,166 (GRCm39) missense probably benign 0.18
R6426:Fhip2a UTSW 19 57,371,610 (GRCm39) missense probably damaging 1.00
R6765:Fhip2a UTSW 19 57,367,177 (GRCm39) missense probably benign
R7472:Fhip2a UTSW 19 57,357,017 (GRCm39) missense probably damaging 1.00
R7583:Fhip2a UTSW 19 57,367,034 (GRCm39) missense probably benign 0.01
R7672:Fhip2a UTSW 19 57,373,750 (GRCm39) missense possibly damaging 0.95
R8159:Fhip2a UTSW 19 57,372,697 (GRCm39) critical splice donor site probably null
R8510:Fhip2a UTSW 19 57,370,752 (GRCm39) missense probably benign 0.16
R9060:Fhip2a UTSW 19 57,361,450 (GRCm39) missense probably damaging 0.99
R9214:Fhip2a UTSW 19 57,373,756 (GRCm39) missense probably damaging 0.99
R9689:Fhip2a UTSW 19 57,369,710 (GRCm39) missense probably benign 0.01
X0023:Fhip2a UTSW 19 57,372,579 (GRCm39) nonsense probably null
X0062:Fhip2a UTSW 19 57,373,689 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACATCTCTTATCTGCGTC -3'
(R):5'- TAAGGTAACATCTCTCCAAAGGGG -3'

Sequencing Primer
(F):5'- AGTATCTTCTGATTGGTACCCAG -3'
(R):5'- GAGAGTTCATGAGTGTTTATAGGCAC -3'
Posted On 2022-02-07