Incidental Mutation 'R9235:Slc6a13'
ID 700420
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R9235 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121301984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 189 (R189G)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580] [ENSMUST00000142419]
AlphaFold P31649
Predicted Effect probably damaging
Transcript: ENSMUST00000064580
AA Change: R189G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: R189G

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142419
SMART Domains Protein: ENSMUSP00000120689
Gene: ENSMUSG00000030108

DomainStartEndE-ValueType
Pfam:SNF 43 192 4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,623,518 (GRCm39) I76N possibly damaging Het
4930558K02Rik T C 1: 161,780,172 (GRCm39) H114R possibly damaging Het
C2 T C 17: 35,083,845 (GRCm39) D414G probably damaging Het
Catsper4 C T 4: 133,954,606 (GRCm39) D15N probably benign Het
Ccnb2 A G 9: 70,318,163 (GRCm39) V203A probably damaging Het
Cd2 A G 3: 101,195,159 (GRCm39) F13L probably benign Het
Cwf19l1 G A 19: 44,113,275 (GRCm39) A227V probably damaging Het
Dis3l2 G A 1: 86,749,061 (GRCm39) D176N possibly damaging Het
Dmpk T G 7: 18,822,141 (GRCm39) N366K probably damaging Het
Dnajb12 C T 10: 59,728,799 (GRCm39) T229I probably benign Het
Efcab3 A G 11: 104,907,987 (GRCm39) D4479G probably benign Het
Fat3 T A 9: 15,833,674 (GRCm39) E126V probably null Het
Fbxo27 T A 7: 28,397,756 (GRCm39) Y264* probably null Het
Fign A G 2: 63,810,907 (GRCm39) M121T probably damaging Het
Flt3 T C 5: 147,320,202 (GRCm39) Y54C possibly damaging Het
Frmd4a G A 2: 4,599,366 (GRCm39) R460H probably damaging Het
Igkv4-53 A T 6: 69,626,301 (GRCm39) I13N possibly damaging Het
Islr T A 9: 58,064,944 (GRCm39) I188F possibly damaging Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Klra3 A T 6: 130,311,218 (GRCm39) C54* probably null Het
Klrb1b A G 6: 128,795,547 (GRCm39) F140S probably damaging Het
Kmt2c T C 5: 25,504,997 (GRCm39) E3437G probably damaging Het
Mdn1 C A 4: 32,739,122 (GRCm39) L3648I probably benign Het
Mlxipl C A 5: 135,157,541 (GRCm39) T359K possibly damaging Het
Morc3 T C 16: 93,659,321 (GRCm39) W410R probably damaging Het
Mrpl49 G A 19: 6,105,147 (GRCm39) R105* probably null Het
Myom3 T A 4: 135,541,653 (GRCm39) Y1415N probably damaging Het
Nlgn3 T C X: 100,352,390 (GRCm39) V179A probably damaging Het
Nrap A T 19: 56,330,760 (GRCm39) Y1100* probably null Het
Or14a257 A T 7: 86,138,306 (GRCm39) V151E probably benign Het
Or5d43 A T 2: 88,104,724 (GRCm39) I223N probably damaging Het
Or5t5 T C 2: 86,616,548 (GRCm39) I158T probably benign Het
Or6c8b G T 10: 128,882,051 (GRCm39) Q294K probably benign Het
Pank1 C A 19: 34,856,197 (GRCm39) A94S probably benign Het
Pikfyve C A 1: 65,299,188 (GRCm39) T1613K probably benign Het
Plbd2 T A 5: 120,626,554 (GRCm39) I352L probably benign Het
Plec T C 15: 76,059,701 (GRCm39) D3412G probably damaging Het
Plekhd1 T A 12: 80,768,791 (GRCm39) Y425N possibly damaging Het
Plscr5 A G 9: 92,086,417 (GRCm39) N129S possibly damaging Het
Prkdc T A 16: 15,651,751 (GRCm39) M3796K probably damaging Het
Psme3 A T 11: 101,211,594 (GRCm39) E213D possibly damaging Het
Ptprn2 G A 12: 117,233,271 (GRCm39) probably null Het
Sema5a A G 15: 32,619,034 (GRCm39) S521G probably benign Het
Slc34a2 A T 5: 53,226,667 (GRCm39) M597L probably benign Het
Smyd4 G A 11: 75,295,689 (GRCm39) E782K probably benign Het
Sspo T A 6: 48,466,718 (GRCm39) C4078S probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Ttc21a G T 9: 119,774,559 (GRCm39) R271L probably benign Het
Ubr5 A G 15: 38,045,982 (GRCm39) L114P Het
Ugt1a2 A G 1: 88,128,488 (GRCm39) R44G possibly damaging Het
Ulk4 G A 9: 120,981,217 (GRCm39) T907I probably benign Het
Unc13a G T 8: 72,115,912 (GRCm39) L97I probably benign Het
Uqcc6 A T 10: 82,458,586 (GRCm39) C22S possibly damaging Het
Vmn1r25 A G 6: 57,955,488 (GRCm39) L267P probably damaging Het
Vmn2r101 T A 17: 19,810,238 (GRCm39) N341K probably damaging Het
Wdr3 T A 3: 100,054,023 (GRCm39) Q534L probably benign Het
Zfp28 A T 7: 6,397,605 (GRCm39) H680L probably damaging Het
Zfp986 T A 4: 145,625,759 (GRCm39) F140I probably benign Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R7935:Slc6a13 UTSW 6 121,311,450 (GRCm39) missense possibly damaging 0.46
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AACGTTCATAGCCCTGGGTTC -3'
(R):5'- TTCAGGAAGGAAGCCACATG -3'

Sequencing Primer
(F):5'- GGGTTCTAACCCTTACACAG -3'
(R):5'- TGCCTGGACCAGCCTAAAG -3'
Posted On 2022-02-07