Incidental Mutation 'R0760:Ccni'
ID70043
Institutional Source Beutler Lab
Gene Symbol Ccni
Ensembl Gene ENSMUSG00000063015
Gene Namecyclin I
Synonyms
MMRRC Submission 038940-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0760 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location93181933-93206495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93183329 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 261 (V261A)
Ref Sequence ENSEMBL: ENSMUSP00000050189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058550] [ENSMUST00000151568] [ENSMUST00000201823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058550
AA Change: V261A

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050189
Gene: ENSMUSG00000063015
AA Change: V261A

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123033
Predicted Effect probably benign
Transcript: ENSMUST00000151568
SMART Domains Protein: ENSMUSP00000116224
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201581
Predicted Effect probably benign
Transcript: ENSMUST00000201823
AA Change: V137A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143972
Gene: ENSMUSG00000063015
AA Change: V137A

DomainStartEndE-ValueType
CYCLIN 3 89 7.4e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202150
Meta Mutation Damage Score 0.0874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,347,702 V120A possibly damaging Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Alcam C T 16: 52,295,672 V180M probably benign Het
Catip A G 1: 74,362,959 probably benign Het
Ccm2l A C 2: 153,072,184 N298T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5d1 A G 11: 69,395,173 F41L probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fbxw8 A G 5: 118,065,901 probably null Het
Gpaa1 T C 15: 76,331,919 I33T probably benign Het
Grip1 T A 10: 120,018,078 S512T probably damaging Het
Gtpbp1 G A 15: 79,719,155 G140E probably damaging Het
Hspa4l T A 3: 40,784,723 L681* probably null Het
Hspg2 A G 4: 137,512,349 T456A probably damaging Het
Igkv3-1 A T 6: 70,704,135 D106V probably damaging Het
Inhbc C T 10: 127,357,368 G260S probably damaging Het
Itga2 C T 13: 114,859,632 V708I possibly damaging Het
Kif5c T C 2: 49,688,753 I131T probably damaging Het
Kmt2c A G 5: 25,353,317 Y1133H possibly damaging Het
Lama2 A G 10: 27,044,433 probably null Het
N4bp1 A G 8: 86,846,912 Y744H probably damaging Het
Olfr128 C T 17: 37,924,114 Q183* probably null Het
Olfr354 A G 2: 36,907,221 S92G probably benign Het
Ovol2 A G 2: 144,331,759 probably null Het
Pappa2 C A 1: 158,716,961 probably null Het
Pcdh10 G A 3: 45,380,570 E440K probably benign Het
Pcsk4 A G 10: 80,325,941 probably benign Het
Plcl2 A G 17: 50,608,774 N937S possibly damaging Het
Ppp6r1 A G 7: 4,639,723 F541L probably benign Het
Rad54l2 A G 9: 106,719,606 probably null Het
Ranbp2 C T 10: 58,476,791 P1111L possibly damaging Het
Rasal3 A G 17: 32,392,172 F929S probably benign Het
Rnf111 A G 9: 70,429,678 V909A probably damaging Het
Rnf168 A G 16: 32,298,386 probably null Het
Slc2a5 T C 4: 150,139,667 L244P probably benign Het
Snta1 T A 2: 154,380,940 I288F probably damaging Het
Sv2a G A 3: 96,188,182 C297Y probably damaging Het
Trim44 C T 2: 102,400,560 probably benign Het
Uggt1 A T 1: 36,161,724 I1164N possibly damaging Het
Other mutations in Ccni
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02301:Ccni APN 5 93188175 missense possibly damaging 0.77
IGL02545:Ccni APN 5 93187777 missense probably benign 0.01
IGL02865:Ccni APN 5 93183336 missense probably benign 0.04
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0541:Ccni UTSW 5 93187704 missense probably benign 0.00
R0718:Ccni UTSW 5 93202316 missense probably benign 0.00
R1656:Ccni UTSW 5 93188074 splice site probably null
R1752:Ccni UTSW 5 93202456 start gained probably benign
R1817:Ccni UTSW 5 93188108 missense possibly damaging 0.89
R3551:Ccni UTSW 5 93187761 missense probably benign 0.05
R3552:Ccni UTSW 5 93187761 missense probably benign 0.05
R3956:Ccni UTSW 5 93183404 missense probably damaging 1.00
R4809:Ccni UTSW 5 93187570 intron probably benign
R4901:Ccni UTSW 5 93183144 missense probably damaging 1.00
R4937:Ccni UTSW 5 93188254 splice site probably null
R4975:Ccni UTSW 5 93187694 missense possibly damaging 0.83
R7120:Ccni UTSW 5 93183331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCATCGTAGAAGTCATCCACCTC -3'
(R):5'- ACCAGATGTATGTTGGAAGCGCAAG -3'

Sequencing Primer
(F):5'- CCACTTTCCGTTTAGCAGAGG -3'
(R):5'- CACGTATTTCAGAAGAAGGCTC -3'
Posted On2013-09-30