Mutagenetix > Incidental Mutation

Incidental Mutation 'R9235:Ptprn2'

700443

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R9235 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 117269651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably null
Transcript: ENSMUST00000070733

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190247

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190007I07Rik	A	T	10: 82,622,752	C22S	possibly damaging	Het
4921524L21Rik	T	A	18: 6,623,518	I76N	possibly damaging	Het
4930558K02Rik	T	C	1: 161,952,603	H114R	possibly damaging	Het
C2	T	C	17: 34,864,869	D414G	probably damaging	Het
Catsper4	C	T	4: 134,227,295	D15N	probably benign	Het
Ccnb2	A	G	9: 70,410,881	V203A	probably damaging	Het
Cd2	A	G	3: 101,287,843	F13L	probably benign	Het
Cwf19l1	G	A	19: 44,124,836	A227V	probably damaging	Het
Dis3l2	G	A	1: 86,821,339	D176N	possibly damaging	Het
Dmpk	T	G	7: 19,088,216	N366K	probably damaging	Het
Dnajb12	C	T	10: 59,892,977	T229I	probably benign	Het
Fat3	T	A	9: 15,922,378	E126V	probably null	Het
Fbxo27	T	A	7: 28,698,331	Y264*	probably null	Het
Fign	A	G	2: 63,980,563	M121T	probably damaging	Het
Flt3	T	C	5: 147,383,392	Y54C	possibly damaging	Het
Frmd4a	G	A	2: 4,594,555	R460H	probably damaging	Het
Gm11639	A	G	11: 105,017,161	D4479G	probably benign	Het
Igkv4-53	A	T	6: 69,649,317	I13N	possibly damaging	Het
Islr	T	A	9: 58,157,661	I188F	possibly damaging	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Klra3	A	T	6: 130,334,255	C54*	probably null	Het
Klrb1b	A	G	6: 128,818,584	F140S	probably damaging	Het
Kmt2c	T	C	5: 25,299,999	E3437G	probably damaging	Het
Mdn1	C	A	4: 32,739,122	L3648I	probably benign	Het
Mlxipl	C	A	5: 135,128,687	T359K	possibly damaging	Het
Morc3	T	C	16: 93,862,433	W410R	probably damaging	Het
Mrpl49	G	A	19: 6,055,117	R105*	probably null	Het
Myom3	T	A	4: 135,814,342	Y1415N	probably damaging	Het
Nlgn3	T	C	X: 101,308,784	V179A	probably damaging	Het
Nrap	A	T	19: 56,342,328	Y1100*	probably null	Het
Olfr1093	T	C	2: 86,786,204	I158T	probably benign	Het
Olfr1173	A	T	2: 88,274,380	I223N	probably damaging	Het
Olfr298	A	T	7: 86,489,098	V151E	probably benign	Het
Olfr765	G	T	10: 129,046,182	Q294K	probably benign	Het
Pank1	C	A	19: 34,878,797	A94S	probably benign	Het
Pikfyve	C	A	1: 65,260,029	T1613K	probably benign	Het
Plbd2	T	A	5: 120,488,489	I352L	probably benign	Het
Plec	T	C	15: 76,175,501	D3412G	probably damaging	Het
Plekhd1	T	A	12: 80,722,017	Y425N	possibly damaging	Het
Plscr5	A	G	9: 92,204,364	N129S	possibly damaging	Het
Prkdc	T	A	16: 15,833,887	M3796K	probably damaging	Het
Psme3	A	T	11: 101,320,768	E213D	possibly damaging	Het
Sema5a	A	G	15: 32,618,888	S521G	probably benign	Het
Slc34a2	A	T	5: 53,069,325	M597L	probably benign	Het
Slc6a13	A	G	6: 121,325,025	R189G	probably damaging	Het
Smyd4	G	A	11: 75,404,863	E782K	probably benign	Het
Sspo	T	A	6: 48,489,784	C4078S	probably damaging	Het
Tmco1	C	T	1: 167,308,563		probably benign	Het
Trim28	G	A	7: 13,029,563	A544T	probably benign	Het
Ttc21a	G	T	9: 119,945,493	R271L	probably benign	Het
Ubr5	A	G	15: 38,045,738	L114P		Het
Ugt1a2	A	G	1: 88,200,766	R44G	possibly damaging	Het
Ulk4	G	A	9: 121,152,151	T907I	probably benign	Het
Unc13a	G	T	8: 71,663,268	L97I	probably benign	Het
Vmn1r25	A	G	6: 57,978,503	L267P	probably damaging	Het
Vmn2r101	T	A	17: 19,589,976	N341K	probably damaging	Het
Wdr3	T	A	3: 100,146,707	Q534L	probably benign	Het
Zfp28	A	T	7: 6,394,606	H680L	probably damaging	Het
Zfp986	T	A	4: 145,899,189	F140I	probably benign	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R4970:Ptprn2	UTSW	12	117276595	missense	probably damaging	1.00
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CCAAGCTGCTGAAGGATGAGTG -3'
(R):5'- GCACAGTGATGAATCTCTTGGG -3'

Sequencing Primer
(F):5'- GAGTGTAATAATTTTCAATTGGCCTC -3'
(R):5'- TGAATCTCTTGGGAACAGCC -3'

Posted On

2022-02-07