Incidental Mutation 'R9235:Ptprn2'
ID 700443
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase, receptor type, N polypeptide 2
Synonyms phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock # R9235 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 116485720-117276849 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 117269651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably null
Transcript: ENSMUST00000070733
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190007I07Rik A T 10: 82,622,752 C22S possibly damaging Het
4921524L21Rik T A 18: 6,623,518 I76N possibly damaging Het
4930558K02Rik T C 1: 161,952,603 H114R possibly damaging Het
C2 T C 17: 34,864,869 D414G probably damaging Het
Catsper4 C T 4: 134,227,295 D15N probably benign Het
Ccnb2 A G 9: 70,410,881 V203A probably damaging Het
Cd2 A G 3: 101,287,843 F13L probably benign Het
Cwf19l1 G A 19: 44,124,836 A227V probably damaging Het
Dis3l2 G A 1: 86,821,339 D176N possibly damaging Het
Dmpk T G 7: 19,088,216 N366K probably damaging Het
Dnajb12 C T 10: 59,892,977 T229I probably benign Het
Fat3 T A 9: 15,922,378 E126V probably null Het
Fbxo27 T A 7: 28,698,331 Y264* probably null Het
Fign A G 2: 63,980,563 M121T probably damaging Het
Flt3 T C 5: 147,383,392 Y54C possibly damaging Het
Frmd4a G A 2: 4,594,555 R460H probably damaging Het
Gm11639 A G 11: 105,017,161 D4479G probably benign Het
Igkv4-53 A T 6: 69,649,317 I13N possibly damaging Het
Islr T A 9: 58,157,661 I188F possibly damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Klra3 A T 6: 130,334,255 C54* probably null Het
Klrb1b A G 6: 128,818,584 F140S probably damaging Het
Kmt2c T C 5: 25,299,999 E3437G probably damaging Het
Mdn1 C A 4: 32,739,122 L3648I probably benign Het
Mlxipl C A 5: 135,128,687 T359K possibly damaging Het
Morc3 T C 16: 93,862,433 W410R probably damaging Het
Mrpl49 G A 19: 6,055,117 R105* probably null Het
Myom3 T A 4: 135,814,342 Y1415N probably damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Nrap A T 19: 56,342,328 Y1100* probably null Het
Olfr1093 T C 2: 86,786,204 I158T probably benign Het
Olfr1173 A T 2: 88,274,380 I223N probably damaging Het
Olfr298 A T 7: 86,489,098 V151E probably benign Het
Olfr765 G T 10: 129,046,182 Q294K probably benign Het
Pank1 C A 19: 34,878,797 A94S probably benign Het
Pikfyve C A 1: 65,260,029 T1613K probably benign Het
Plbd2 T A 5: 120,488,489 I352L probably benign Het
Plec T C 15: 76,175,501 D3412G probably damaging Het
Plekhd1 T A 12: 80,722,017 Y425N possibly damaging Het
Plscr5 A G 9: 92,204,364 N129S possibly damaging Het
Prkdc T A 16: 15,833,887 M3796K probably damaging Het
Psme3 A T 11: 101,320,768 E213D possibly damaging Het
Sema5a A G 15: 32,618,888 S521G probably benign Het
Slc34a2 A T 5: 53,069,325 M597L probably benign Het
Slc6a13 A G 6: 121,325,025 R189G probably damaging Het
Smyd4 G A 11: 75,404,863 E782K probably benign Het
Sspo T A 6: 48,489,784 C4078S probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Ttc21a G T 9: 119,945,493 R271L probably benign Het
Ubr5 A G 15: 38,045,738 L114P Het
Ugt1a2 A G 1: 88,200,766 R44G possibly damaging Het
Ulk4 G A 9: 121,152,151 T907I probably benign Het
Unc13a G T 8: 71,663,268 L97I probably benign Het
Vmn1r25 A G 6: 57,978,503 L267P probably damaging Het
Vmn2r101 T A 17: 19,589,976 N341K probably damaging Het
Wdr3 T A 3: 100,146,707 Q534L probably benign Het
Zfp28 A T 7: 6,394,606 H680L probably damaging Het
Zfp986 T A 4: 145,899,189 F140I probably benign Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CCAAGCTGCTGAAGGATGAGTG -3'
(R):5'- GCACAGTGATGAATCTCTTGGG -3'

Sequencing Primer
(F):5'- GAGTGTAATAATTTTCAATTGGCCTC -3'
(R):5'- TGAATCTCTTGGGAACAGCC -3'
Posted On 2022-02-07