Incidental Mutation 'R9236:Ttc41'
ID 700493
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R9236 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86776730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1289 (Y1289F)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000099396]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000075632
AA Change: Y1289F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: Y1289F

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099396
SMART Domains Protein: ENSMUSP00000096994
Gene: ENSMUSG00000054027

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:5_nucleotid 83 526 1.8e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,407,738 T1514A probably benign Het
Abcb1b G A 5: 8,824,893 probably null Het
Adam12 A C 7: 134,012,293 L109R probably benign Het
Adgre1 T A 17: 57,402,782 Y146* probably null Het
Ap5m1 G T 14: 49,073,607 V45L probably benign Het
Bpifa5 A T 2: 154,164,230 I113F probably damaging Het
Cacna1h A T 17: 25,381,450 M1639K probably damaging Het
Celsr1 T C 15: 86,030,850 E974G probably damaging Het
Cggbp1 C T 16: 64,855,955 A128V probably benign Het
Col7a1 G T 9: 108,960,616 R898L unknown Het
Cycs C T 6: 50,566,527 probably benign Het
Cyp2c54 A T 19: 40,072,494 Y68* probably null Het
Dock9 T C 14: 121,639,558 D467G probably damaging Het
Eif2s1 A T 12: 78,874,569 I83L probably benign Het
Eppk1 T A 15: 76,106,310 R2124* probably null Het
Fkbp15 G C 4: 62,336,427 L279V probably damaging Het
Fndc1 A G 17: 7,773,628 V412A unknown Het
Gfap A G 11: 102,895,501 I194T probably damaging Het
Gpatch2 C A 1: 187,233,780 T350K probably benign Het
Hecw1 C T 13: 14,316,058 G783D possibly damaging Het
Hipk1 A T 3: 103,764,473 W437R probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hr C T 14: 70,571,956 P1136S probably damaging Het
Il1rl2 T A 1: 40,329,061 N130K probably damaging Het
Kif13b A G 14: 64,744,934 I532V probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lrba T A 3: 86,353,759 I1474K probably benign Het
Luc7l3 T C 11: 94,295,946 E371G unknown Het
Myo5b T A 18: 74,720,863 D1184E probably benign Het
N4bp2l2 A G 5: 150,662,014 M167T probably benign Het
N4bp2l2 T C 5: 150,662,269 H82R probably benign Het
Ndufaf1 T C 2: 119,660,231 E118G possibly damaging Het
Nedd9 A T 13: 41,338,677 V119E possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Ntmt1 T A 2: 30,822,395 L150Q probably damaging Het
Olfr1097 C T 2: 86,890,278 S299N probably benign Het
Olfr1451 G T 19: 12,999,399 V138F probably damaging Het
Olfr836 A G 9: 19,121,910 *315W probably null Het
Olfr889 A T 9: 38,116,200 M140L possibly damaging Het
Osbpl8 A G 10: 111,270,635 N301S probably benign Het
Pgm5 A T 19: 24,861,639 S51T probably benign Het
Pitx2 A G 3: 129,215,696 K88R probably damaging Het
Pnmal2 A T 7: 16,946,039 D316V unknown Het
Pop1 C A 15: 34,499,412 P41Q probably damaging Het
Rcor1 A C 12: 111,103,646 K292N Het
Rps6kc1 C T 1: 190,800,003 D601N probably damaging Het
Sema7a A T 9: 57,955,125 I204F probably damaging Het
Slc29a4 T C 5: 142,712,947 L121P probably damaging Het
Slc4a2 A G 5: 24,439,310 T983A probably benign Het
Slc4a4 C T 5: 89,046,299 R213* probably null Het
Tbc1d2 G A 4: 46,609,029 T736I probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trip12 A C 1: 84,725,829 L1895R probably damaging Het
Vmn1r70 G A 7: 10,634,089 C168Y probably damaging Het
Vtcn1 C A 3: 100,888,217 R167S probably benign Het
Wdr66 T C 5: 123,290,062 C980R probably damaging Het
Zfp369 G A 13: 65,297,196 V718I probably benign Het
Zfp608 T C 18: 54,899,282 T529A probably benign Het
Zfp936 A G 7: 43,187,498 N46D probably benign Het
Zfp974 A G 7: 27,910,917 V461A possibly damaging Het
Zgrf1 A G 3: 127,584,663 N1024S probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8902:Ttc41 UTSW 10 86713001 missense probably benign 0.06
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGTCAGGCTTCAGACTCAC -3'
(R):5'- TGTGCACACTTGTACCACAC -3'

Sequencing Primer
(F):5'- TAAGACGGTCTCGCTCATTGACAAG -3'
(R):5'- CACACACATACGCCTTTCAAGAG -3'
Posted On 2022-02-07