Incidental Mutation 'R0760:Rad54l2'
ID70050
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission 038940-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0760 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 106719606 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect probably null
Transcript: ENSMUST00000046502
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190363
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 92.8%
Validation Efficiency 95% (39/41)
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A G 6: 124,347,702 V120A possibly damaging Het
Adamts2 T C 11: 50,775,326 V383A probably damaging Het
Alcam C T 16: 52,295,672 V180M probably benign Het
Catip A G 1: 74,362,959 probably benign Het
Ccm2l A C 2: 153,072,184 N298T probably damaging Het
Ccni A G 5: 93,183,329 V261A possibly damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5d1 A G 11: 69,395,173 F41L probably benign Het
Fam71d A G 12: 78,715,153 D197G probably damaging Het
Fbxw8 A G 5: 118,065,901 probably null Het
Gpaa1 T C 15: 76,331,919 I33T probably benign Het
Grip1 T A 10: 120,018,078 S512T probably damaging Het
Gtpbp1 G A 15: 79,719,155 G140E probably damaging Het
Hspa4l T A 3: 40,784,723 L681* probably null Het
Hspg2 A G 4: 137,512,349 T456A probably damaging Het
Igkv3-1 A T 6: 70,704,135 D106V probably damaging Het
Inhbc C T 10: 127,357,368 G260S probably damaging Het
Itga2 C T 13: 114,859,632 V708I possibly damaging Het
Kif5c T C 2: 49,688,753 I131T probably damaging Het
Kmt2c A G 5: 25,353,317 Y1133H possibly damaging Het
Lama2 A G 10: 27,044,433 probably null Het
N4bp1 A G 8: 86,846,912 Y744H probably damaging Het
Olfr128 C T 17: 37,924,114 Q183* probably null Het
Olfr354 A G 2: 36,907,221 S92G probably benign Het
Ovol2 A G 2: 144,331,759 probably null Het
Pappa2 C A 1: 158,716,961 probably null Het
Pcdh10 G A 3: 45,380,570 E440K probably benign Het
Pcsk4 A G 10: 80,325,941 probably benign Het
Plcl2 A G 17: 50,608,774 N937S possibly damaging Het
Ppp6r1 A G 7: 4,639,723 F541L probably benign Het
Ranbp2 C T 10: 58,476,791 P1111L possibly damaging Het
Rasal3 A G 17: 32,392,172 F929S probably benign Het
Rnf111 A G 9: 70,429,678 V909A probably damaging Het
Rnf168 A G 16: 32,298,386 probably null Het
Slc2a5 T C 4: 150,139,667 L244P probably benign Het
Snta1 T A 2: 154,380,940 I288F probably damaging Het
Sv2a G A 3: 96,188,182 C297Y probably damaging Het
Trim44 C T 2: 102,400,560 probably benign Het
Uggt1 A T 1: 36,161,724 I1164N possibly damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 splice site probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106719641 missense probably benign 0.00
R8084:Rad54l2 UTSW 9 106713502 missense possibly damaging 0.63
R8552:Rad54l2 UTSW 9 106693578 missense possibly damaging 0.77
R8768:Rad54l2 UTSW 9 106719610 missense probably benign 0.04
R8952:Rad54l2 UTSW 9 106688851 unclassified probably benign
R8953:Rad54l2 UTSW 9 106693262 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAGGCTAGACTACAGGGAAAGAC -3'
(R):5'- GAAGCACTTGGAAATACGTTTGAGCTG -3'

Sequencing Primer
(F):5'- TAGACTACAGGGAAAGACTTCAATAC -3'
(R):5'- cgctctacccgctgaac -3'
Posted On2013-09-30