Mutagenetix > Incidental Mutation

Incidental Mutation 'R0760:Rad54l2'

70050

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

038940-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0760 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 106719606 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000046502

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190363

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.8%
20x: 92.8%

Validation Efficiency

95% (39/41)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	G	6: 124,347,702	V120A	possibly damaging	Het
Adamts2	T	C	11: 50,775,326	V383A	probably damaging	Het
Alcam	C	T	16: 52,295,672	V180M	probably benign	Het
Catip	A	G	1: 74,362,959		probably benign	Het
Ccm2l	A	C	2: 153,072,184	N298T	probably damaging	Het
Ccni	A	G	5: 93,183,329	V261A	possibly damaging	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cyb5d1	A	G	11: 69,395,173	F41L	probably benign	Het
Fam71d	A	G	12: 78,715,153	D197G	probably damaging	Het
Fbxw8	A	G	5: 118,065,901		probably null	Het
Gpaa1	T	C	15: 76,331,919	I33T	probably benign	Het
Grip1	T	A	10: 120,018,078	S512T	probably damaging	Het
Gtpbp1	G	A	15: 79,719,155	G140E	probably damaging	Het
Hspa4l	T	A	3: 40,784,723	L681*	probably null	Het
Hspg2	A	G	4: 137,512,349	T456A	probably damaging	Het
Igkv3-1	A	T	6: 70,704,135	D106V	probably damaging	Het
Inhbc	C	T	10: 127,357,368	G260S	probably damaging	Het
Itga2	C	T	13: 114,859,632	V708I	possibly damaging	Het
Kif5c	T	C	2: 49,688,753	I131T	probably damaging	Het
Kmt2c	A	G	5: 25,353,317	Y1133H	possibly damaging	Het
Lama2	A	G	10: 27,044,433		probably null	Het
N4bp1	A	G	8: 86,846,912	Y744H	probably damaging	Het
Olfr128	C	T	17: 37,924,114	Q183*	probably null	Het
Olfr354	A	G	2: 36,907,221	S92G	probably benign	Het
Ovol2	A	G	2: 144,331,759		probably null	Het
Pappa2	C	A	1: 158,716,961		probably null	Het
Pcdh10	G	A	3: 45,380,570	E440K	probably benign	Het
Pcsk4	A	G	10: 80,325,941		probably benign	Het
Plcl2	A	G	17: 50,608,774	N937S	possibly damaging	Het
Ppp6r1	A	G	7: 4,639,723	F541L	probably benign	Het
Ranbp2	C	T	10: 58,476,791	P1111L	possibly damaging	Het
Rasal3	A	G	17: 32,392,172	F929S	probably benign	Het
Rnf111	A	G	9: 70,429,678	V909A	probably damaging	Het
Rnf168	A	G	16: 32,298,386		probably null	Het
Slc2a5	T	C	4: 150,139,667	L244P	probably benign	Het
Snta1	T	A	2: 154,380,940	I288F	probably damaging	Het
Sv2a	G	A	3: 96,188,182	C297Y	probably damaging	Het
Trim44	C	T	2: 102,400,560		probably benign	Het
Uggt1	A	T	1: 36,161,724	I1164N	possibly damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGCTAGACTACAGGGAAAGAC -3'
(R):5'- GAAGCACTTGGAAATACGTTTGAGCTG -3'

Sequencing Primer
(F):5'- TAGACTACAGGGAAAGACTTCAATAC -3'
(R):5'- cgctctacccgctgaac -3'

Posted On

2013-09-30