Incidental Mutation 'R9236:Myo5b'
ID 700515
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
Accession Numbers
Essential gene? Possibly essential (E-score: 0.707) question?
Stock # R9236 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 74440936-74771493 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74720863 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1184 (D1184E)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: D1184E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: D1184E

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: D1184E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: D1184E

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177366
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,407,738 T1514A probably benign Het
Abcb1b G A 5: 8,824,893 probably null Het
Adam12 A C 7: 134,012,293 L109R probably benign Het
Adgre1 T A 17: 57,402,782 Y146* probably null Het
Ap5m1 G T 14: 49,073,607 V45L probably benign Het
Bpifa5 A T 2: 154,164,230 I113F probably damaging Het
Cacna1h A T 17: 25,381,450 M1639K probably damaging Het
Celsr1 T C 15: 86,030,850 E974G probably damaging Het
Cggbp1 C T 16: 64,855,955 A128V probably benign Het
Col7a1 G T 9: 108,960,616 R898L unknown Het
Cycs C T 6: 50,566,527 probably benign Het
Cyp2c54 A T 19: 40,072,494 Y68* probably null Het
Dock9 T C 14: 121,639,558 D467G probably damaging Het
Eif2s1 A T 12: 78,874,569 I83L probably benign Het
Eppk1 T A 15: 76,106,310 R2124* probably null Het
Fkbp15 G C 4: 62,336,427 L279V probably damaging Het
Fndc1 A G 17: 7,773,628 V412A unknown Het
Gfap A G 11: 102,895,501 I194T probably damaging Het
Gpatch2 C A 1: 187,233,780 T350K probably benign Het
Hecw1 C T 13: 14,316,058 G783D possibly damaging Het
Hipk1 A T 3: 103,764,473 W437R probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Hr C T 14: 70,571,956 P1136S probably damaging Het
Il1rl2 T A 1: 40,329,061 N130K probably damaging Het
Kif13b A G 14: 64,744,934 I532V probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lrba T A 3: 86,353,759 I1474K probably benign Het
Luc7l3 T C 11: 94,295,946 E371G unknown Het
N4bp2l2 A G 5: 150,662,014 M167T probably benign Het
N4bp2l2 T C 5: 150,662,269 H82R probably benign Het
Ndufaf1 T C 2: 119,660,231 E118G possibly damaging Het
Nedd9 A T 13: 41,338,677 V119E possibly damaging Het
Nlgn3 T C X: 101,308,784 V179A probably damaging Het
Ntmt1 T A 2: 30,822,395 L150Q probably damaging Het
Olfr1097 C T 2: 86,890,278 S299N probably benign Het
Olfr1451 G T 19: 12,999,399 V138F probably damaging Het
Olfr836 A G 9: 19,121,910 *315W probably null Het
Olfr889 A T 9: 38,116,200 M140L possibly damaging Het
Osbpl8 A G 10: 111,270,635 N301S probably benign Het
Pgm5 A T 19: 24,861,639 S51T probably benign Het
Pitx2 A G 3: 129,215,696 K88R probably damaging Het
Pnmal2 A T 7: 16,946,039 D316V unknown Het
Pop1 C A 15: 34,499,412 P41Q probably damaging Het
Rcor1 A C 12: 111,103,646 K292N Het
Rps6kc1 C T 1: 190,800,003 D601N probably damaging Het
Sema7a A T 9: 57,955,125 I204F probably damaging Het
Slc29a4 T C 5: 142,712,947 L121P probably damaging Het
Slc4a2 A G 5: 24,439,310 T983A probably benign Het
Slc4a4 C T 5: 89,046,299 R213* probably null Het
Tbc1d2 G A 4: 46,609,029 T736I probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Trip12 A C 1: 84,725,829 L1895R probably damaging Het
Ttc41 A T 10: 86,776,730 Y1289F probably damaging Het
Vmn1r70 G A 7: 10,634,089 C168Y probably damaging Het
Vtcn1 C A 3: 100,888,217 R167S probably benign Het
Wdr66 T C 5: 123,290,062 C980R probably damaging Het
Zfp369 G A 13: 65,297,196 V718I probably benign Het
Zfp608 T C 18: 54,899,282 T529A probably benign Het
Zfp936 A G 7: 43,187,498 N46D probably benign Het
Zfp974 A G 7: 27,910,917 V461A possibly damaging Het
Zgrf1 A G 3: 127,584,663 N1024S probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74731754 missense probably benign
BB017:Myo5b UTSW 18 74731754 missense probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 splice site probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
R7930:Myo5b UTSW 18 74731754 missense probably benign
R8013:Myo5b UTSW 18 74760899 nonsense probably null
R8271:Myo5b UTSW 18 74627190 missense probably damaging 1.00
R8312:Myo5b UTSW 18 74733962 missense probably damaging 1.00
R8383:Myo5b UTSW 18 74643978 missense probably benign 0.05
R8384:Myo5b UTSW 18 74742202 missense probably damaging 1.00
R8474:Myo5b UTSW 18 74770340 missense probably damaging 1.00
R8825:Myo5b UTSW 18 74759098 missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74707972 missense probably benign 0.04
R9283:Myo5b UTSW 18 74644078 missense probably benign 0.16
R9370:Myo5b UTSW 18 74627175 missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74744760 missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74728897 missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74714946 missense probably damaging 0.99
R9676:Myo5b UTSW 18 74759160 missense probably benign 0.22
R9725:Myo5b UTSW 18 74723770 missense probably benign
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Z1177:Myo5b UTSW 18 74617017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTGGGCTACTATTTGGAGGAG -3'
(R):5'- ATTTTAACCCGAGCTGCTGC -3'

Sequencing Primer
(F):5'- TACTATTTGGAGGAGGTGGGGAATAC -3'
(R):5'- TAACCCGAGCTGCTGCAAGTAG -3'
Posted On 2022-02-07