Incidental Mutation 'R9237:Stat4'
ID 700520
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Name signal transducer and activator of transcription 4
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 52026307-52146348 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52146073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 742 (N742S)
Ref Sequence ENSEMBL: ENSMUSP00000027277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027277
AA Change: N742S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: N742S

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168302
AA Change: N742S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: N742S

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,318,557 (GRCm39) N1815K probably damaging Het
Acat1 C A 9: 53,494,816 (GRCm39) A359S probably damaging Het
Actn1 T C 12: 80,240,470 (GRCm39) N206D possibly damaging Het
Adgrf4 T A 17: 42,980,782 (GRCm39) H101L probably benign Het
Ager T A 17: 34,816,869 (GRCm39) M1K probably null Het
Akap12 T C 10: 4,307,231 (GRCm39) I1452T probably benign Het
Arap3 G A 18: 38,112,934 (GRCm39) A1092V possibly damaging Het
Bnip5 T C 17: 29,123,522 (GRCm39) E392G probably benign Het
C8b A G 4: 104,650,481 (GRCm39) T430A probably benign Het
Dars2 G A 1: 160,873,025 (GRCm39) R455W probably damaging Het
Erbb4 T G 1: 68,081,601 (GRCm39) Q1144H possibly damaging Het
Exoc2 G A 13: 31,048,858 (GRCm39) H732Y probably benign Het
Fhad1 T A 4: 141,632,483 (GRCm39) M1219L probably benign Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Gna15 T C 10: 81,359,683 (GRCm39) K36E possibly damaging Het
Gpr156 C T 16: 37,825,648 (GRCm39) Q622* probably null Het
Grip1 C T 10: 119,911,310 (GRCm39) S1091L probably benign Het
H4c12 A G 13: 21,934,534 (GRCm39) S48P probably damaging Het
Helt A G 8: 46,745,536 (GRCm39) F154L probably benign Het
Ide T C 19: 37,307,898 (GRCm39) N38S Het
Ighg2b A T 12: 113,270,217 (GRCm39) V267E Het
Map3k10 C T 7: 27,357,842 (GRCm39) W645* probably null Het
Mcrip1 G A 11: 120,435,542 (GRCm39) P31L probably damaging Het
Mttp T C 3: 137,810,444 (GRCm39) E657G probably benign Het
Myom1 C T 17: 71,408,051 (GRCm39) T1195I probably damaging Het
Myom2 T C 8: 15,152,591 (GRCm39) V646A possibly damaging Het
Nlrc3 A T 16: 3,783,073 (GRCm39) M128K probably benign Het
Nr2f6 A C 8: 71,831,073 (GRCm39) C112W probably damaging Het
Or5af1 A T 11: 58,722,057 (GRCm39) I26F possibly damaging Het
Or5m13b T A 2: 85,754,267 (GRCm39) Y218* probably null Het
P2rx3 T C 2: 84,853,896 (GRCm39) N139S probably benign Het
Pcdha11 T A 18: 37,145,260 (GRCm39) N450K probably damaging Het
Phb1 T C 11: 95,566,034 (GRCm39) I106T possibly damaging Het
Phyhipl C A 10: 70,406,720 (GRCm39) R78L possibly damaging Het
Pmfbp1 A G 8: 110,246,932 (GRCm39) D268G probably damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Rcbtb2 C A 14: 73,411,936 (GRCm39) H408Q probably damaging Het
Sptbn1 A T 11: 30,096,803 (GRCm39) V271E probably damaging Het
Sptlc3 T A 2: 139,408,605 (GRCm39) V240E probably benign Het
Tas2r118 T A 6: 23,969,617 (GRCm39) Y148F probably benign Het
Trmt5 G T 12: 73,331,568 (GRCm39) Q163K probably benign Het
Ube2d1 T A 10: 71,097,925 (GRCm39) I37F probably damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vps13b C T 15: 35,841,479 (GRCm39) P2503L probably damaging Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52,142,037 (GRCm39) missense probably damaging 1.00
IGL00482:Stat4 APN 1 52,113,856 (GRCm39) missense probably benign 0.05
IGL01395:Stat4 APN 1 52,051,033 (GRCm39) missense probably damaging 1.00
IGL01533:Stat4 APN 1 52,137,578 (GRCm39) missense probably damaging 1.00
IGL01943:Stat4 APN 1 52,136,014 (GRCm39) missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52,142,024 (GRCm39) missense probably damaging 1.00
IGL02151:Stat4 APN 1 52,053,029 (GRCm39) missense probably damaging 0.99
IGL02601:Stat4 APN 1 52,137,574 (GRCm39) missense probably damaging 1.00
R0016:Stat4 UTSW 1 52,107,939 (GRCm39) missense probably benign 0.01
R0243:Stat4 UTSW 1 52,051,016 (GRCm39) missense probably benign 0.22
R0329:Stat4 UTSW 1 52,130,029 (GRCm39) intron probably benign
R0973:Stat4 UTSW 1 52,135,979 (GRCm39) missense probably damaging 0.99
R1144:Stat4 UTSW 1 52,123,288 (GRCm39) splice site probably benign
R1187:Stat4 UTSW 1 52,115,836 (GRCm39) missense probably damaging 1.00
R1331:Stat4 UTSW 1 52,053,086 (GRCm39) missense probably benign 0.20
R1401:Stat4 UTSW 1 52,111,106 (GRCm39) splice site probably benign
R1529:Stat4 UTSW 1 52,050,952 (GRCm39) missense probably damaging 1.00
R1711:Stat4 UTSW 1 52,146,084 (GRCm39) missense probably damaging 1.00
R2213:Stat4 UTSW 1 52,053,014 (GRCm39) missense probably damaging 0.98
R3003:Stat4 UTSW 1 52,142,145 (GRCm39) missense probably damaging 1.00
R3683:Stat4 UTSW 1 52,052,981 (GRCm39) missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52,050,955 (GRCm39) missense probably benign 0.07
R3919:Stat4 UTSW 1 52,135,981 (GRCm39) missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52,113,866 (GRCm39) missense probably benign
R4373:Stat4 UTSW 1 52,111,100 (GRCm39) critical splice donor site probably null
R5024:Stat4 UTSW 1 52,121,729 (GRCm39) missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52,111,054 (GRCm39) missense probably damaging 0.97
R5206:Stat4 UTSW 1 52,144,395 (GRCm39) missense probably damaging 0.99
R5944:Stat4 UTSW 1 52,113,898 (GRCm39) missense probably damaging 1.00
R5961:Stat4 UTSW 1 52,104,543 (GRCm39) missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52,136,026 (GRCm39) missense probably damaging 0.96
R6161:Stat4 UTSW 1 52,113,836 (GRCm39) missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52,141,360 (GRCm39) missense probably null 1.00
R6701:Stat4 UTSW 1 52,142,133 (GRCm39) missense probably damaging 1.00
R6767:Stat4 UTSW 1 52,115,742 (GRCm39) missense probably benign 0.00
R6989:Stat4 UTSW 1 52,107,974 (GRCm39) missense probably benign 0.09
R7507:Stat4 UTSW 1 52,117,733 (GRCm39) missense probably damaging 1.00
R7539:Stat4 UTSW 1 52,110,868 (GRCm39) splice site probably null
R7546:Stat4 UTSW 1 52,137,622 (GRCm39) missense probably damaging 0.98
R7616:Stat4 UTSW 1 52,053,037 (GRCm39) nonsense probably null
R7751:Stat4 UTSW 1 52,121,711 (GRCm39) missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52,118,932 (GRCm39) missense probably damaging 1.00
R8311:Stat4 UTSW 1 52,142,075 (GRCm39) missense probably damaging 1.00
R8419:Stat4 UTSW 1 52,137,637 (GRCm39) missense possibly damaging 0.89
R8679:Stat4 UTSW 1 52,118,991 (GRCm39) missense probably null 1.00
R8699:Stat4 UTSW 1 52,111,096 (GRCm39) missense probably benign
R8738:Stat4 UTSW 1 52,115,711 (GRCm39) missense possibly damaging 0.95
R8921:Stat4 UTSW 1 52,144,892 (GRCm39) missense probably benign 0.39
R9013:Stat4 UTSW 1 52,050,957 (GRCm39) missense probably benign 0.00
R9729:Stat4 UTSW 1 52,141,762 (GRCm39) missense possibly damaging 0.94
R9767:Stat4 UTSW 1 52,141,653 (GRCm39) missense probably damaging 1.00
Z1177:Stat4 UTSW 1 52,137,644 (GRCm39) missense probably null 1.00
Z1177:Stat4 UTSW 1 52,123,258 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTGTGAGTGGACTTCTTAAC -3'
(R):5'- TTAGTCACAGCGCTCCTTG -3'

Sequencing Primer
(F):5'- GGCTGATCAGCCCTAATT -3'
(R):5'- TTGCTGGGAGTGGCACCAAG -3'
Posted On 2022-02-07