Incidental Mutation 'R9237:Stat4'
ID 700520
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Name signal transducer and activator of transcription 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 51987148-52107189 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52106914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 742 (N742S)
Ref Sequence ENSEMBL: ENSMUSP00000027277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027277
AA Change: N742S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: N742S

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168302
AA Change: N742S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: N742S

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,904,548 E392G probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A T 1: 71,279,398 N1815K probably damaging Het
Acat1 C A 9: 53,583,516 A359S probably damaging Het
Actn1 T C 12: 80,193,696 N206D possibly damaging Het
Adgrf4 T A 17: 42,669,891 H101L probably benign Het
Ager T A 17: 34,597,895 M1K probably null Het
Akap12 T C 10: 4,357,231 I1452T probably benign Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
C8b A G 4: 104,793,284 T430A probably benign Het
Dars2 G A 1: 161,045,455 R455W probably damaging Het
Erbb4 T G 1: 68,042,442 Q1144H possibly damaging Het
Exoc2 G A 13: 30,864,875 H732Y probably benign Het
Fhad1 T A 4: 141,905,172 M1219L probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gna15 T C 10: 81,523,849 K36E possibly damaging Het
Gpr156 C T 16: 38,005,286 Q622* probably null Het
Grip1 C T 10: 120,075,405 S1091L probably benign Het
Helt A G 8: 46,292,499 F154L probably benign Het
Hist1h4k A G 13: 21,750,364 S48P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Ighg2b A T 12: 113,306,597 V267E Het
Map3k10 C T 7: 27,658,417 W645* probably null Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Mttp T C 3: 138,104,683 E657G probably benign Het
Myom1 C T 17: 71,101,056 T1195I probably damaging Het
Myom2 T C 8: 15,102,591 V646A possibly damaging Het
Nlrc3 A T 16: 3,965,209 M128K probably benign Het
Nr2f6 A C 8: 71,378,429 C112W probably damaging Het
Olfr1026 T A 2: 85,923,923 Y218* probably null Het
Olfr312 A T 11: 58,831,231 I26F possibly damaging Het
P2rx3 T C 2: 85,023,552 N139S probably benign Het
Pcdha11 T A 18: 37,012,207 N450K probably damaging Het
Phb T C 11: 95,675,208 I106T possibly damaging Het
Phyhipl C A 10: 70,570,890 R78L possibly damaging Het
Pmfbp1 A G 8: 109,520,300 D268G probably damaging Het
Rcbtb2 C A 14: 73,174,496 H408Q probably damaging Het
Sptbn1 A T 11: 30,146,803 V271E probably damaging Het
Sptlc3 T A 2: 139,566,685 V240E probably benign Het
Tas2r118 T A 6: 23,969,618 Y148F probably benign Het
Trmt5 G T 12: 73,284,794 Q163K probably benign Het
Ube2d1 T A 10: 71,262,095 I37F probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vps13b C T 15: 35,841,333 P2503L probably damaging Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52102878 missense probably damaging 1.00
IGL00482:Stat4 APN 1 52074697 missense probably benign 0.05
IGL01395:Stat4 APN 1 52011874 missense probably damaging 1.00
IGL01533:Stat4 APN 1 52098419 missense probably damaging 1.00
IGL01943:Stat4 APN 1 52096855 missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52102865 missense probably damaging 1.00
IGL02151:Stat4 APN 1 52013870 missense probably damaging 0.99
IGL02601:Stat4 APN 1 52098415 missense probably damaging 1.00
R0016:Stat4 UTSW 1 52068780 missense probably benign 0.01
R0243:Stat4 UTSW 1 52011857 missense probably benign 0.22
R0329:Stat4 UTSW 1 52090870 intron probably benign
R0973:Stat4 UTSW 1 52096820 missense probably damaging 0.99
R1144:Stat4 UTSW 1 52084129 splice site probably benign
R1187:Stat4 UTSW 1 52076677 missense probably damaging 1.00
R1331:Stat4 UTSW 1 52013927 missense probably benign 0.20
R1401:Stat4 UTSW 1 52071947 splice site probably benign
R1529:Stat4 UTSW 1 52011793 missense probably damaging 1.00
R1711:Stat4 UTSW 1 52106925 missense probably damaging 1.00
R2213:Stat4 UTSW 1 52013855 missense probably damaging 0.98
R3003:Stat4 UTSW 1 52102986 missense probably damaging 1.00
R3683:Stat4 UTSW 1 52013822 missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52011796 missense probably benign 0.07
R3919:Stat4 UTSW 1 52096822 missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52074707 missense probably benign
R4373:Stat4 UTSW 1 52071941 critical splice donor site probably null
R5024:Stat4 UTSW 1 52082570 missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52071895 missense probably damaging 0.97
R5206:Stat4 UTSW 1 52105236 missense probably damaging 0.99
R5944:Stat4 UTSW 1 52074739 missense probably damaging 1.00
R5961:Stat4 UTSW 1 52065384 missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52096867 missense probably damaging 0.96
R6161:Stat4 UTSW 1 52074677 missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52102201 missense probably null 1.00
R6701:Stat4 UTSW 1 52102974 missense probably damaging 1.00
R6767:Stat4 UTSW 1 52076583 missense probably benign 0.00
R6989:Stat4 UTSW 1 52068815 missense probably benign 0.09
R7507:Stat4 UTSW 1 52078574 missense probably damaging 1.00
R7539:Stat4 UTSW 1 52071709 splice site probably null
R7546:Stat4 UTSW 1 52098463 missense probably damaging 0.98
R7616:Stat4 UTSW 1 52013878 nonsense probably null
R7751:Stat4 UTSW 1 52082552 missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52079773 missense probably damaging 1.00
R8311:Stat4 UTSW 1 52102916 missense probably damaging 1.00
R8419:Stat4 UTSW 1 52098478 missense possibly damaging 0.89
R8679:Stat4 UTSW 1 52079832 missense probably null 1.00
R8699:Stat4 UTSW 1 52071937 missense probably benign
R8738:Stat4 UTSW 1 52076552 missense possibly damaging 0.95
R8921:Stat4 UTSW 1 52105733 missense probably benign 0.39
R9013:Stat4 UTSW 1 52011798 missense probably benign 0.00
R9729:Stat4 UTSW 1 52102603 missense not run
Z1177:Stat4 UTSW 1 52084099 nonsense probably null
Z1177:Stat4 UTSW 1 52098485 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGTGAGTGGACTTCTTAAC -3'
(R):5'- TTAGTCACAGCGCTCCTTG -3'

Sequencing Primer
(F):5'- GGCTGATCAGCCCTAATT -3'
(R):5'- TTGCTGGGAGTGGCACCAAG -3'
Posted On 2022-02-07