Incidental Mutation 'R9237:Erbb4'
ID 700521
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Essential gene? Essential (E-score: 1.000) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 68032186-69108059 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 68042442 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 1144 (Q1144H)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
AlphaFold Q61527
Predicted Effect possibly damaging
Transcript: ENSMUST00000119142
AA Change: Q1160H

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: Q1160H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121473
AA Change: Q1144H

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: Q1144H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,904,548 E392G probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A T 1: 71,279,398 N1815K probably damaging Het
Acat1 C A 9: 53,583,516 A359S probably damaging Het
Actn1 T C 12: 80,193,696 N206D possibly damaging Het
Adgrf4 T A 17: 42,669,891 H101L probably benign Het
Ager T A 17: 34,597,895 M1K probably null Het
Akap12 T C 10: 4,357,231 I1452T probably benign Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
C8b A G 4: 104,793,284 T430A probably benign Het
Dars2 G A 1: 161,045,455 R455W probably damaging Het
Exoc2 G A 13: 30,864,875 H732Y probably benign Het
Fhad1 T A 4: 141,905,172 M1219L probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gna15 T C 10: 81,523,849 K36E possibly damaging Het
Gpr156 C T 16: 38,005,286 Q622* probably null Het
Grip1 C T 10: 120,075,405 S1091L probably benign Het
Helt A G 8: 46,292,499 F154L probably benign Het
Hist1h4k A G 13: 21,750,364 S48P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Ighg2b A T 12: 113,306,597 V267E Het
Map3k10 C T 7: 27,658,417 W645* probably null Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Mttp T C 3: 138,104,683 E657G probably benign Het
Myom1 C T 17: 71,101,056 T1195I probably damaging Het
Myom2 T C 8: 15,102,591 V646A possibly damaging Het
Nlrc3 A T 16: 3,965,209 M128K probably benign Het
Nr2f6 A C 8: 71,378,429 C112W probably damaging Het
Olfr1026 T A 2: 85,923,923 Y218* probably null Het
Olfr312 A T 11: 58,831,231 I26F possibly damaging Het
P2rx3 T C 2: 85,023,552 N139S probably benign Het
Pcdha11 T A 18: 37,012,207 N450K probably damaging Het
Phb T C 11: 95,675,208 I106T possibly damaging Het
Phyhipl C A 10: 70,570,890 R78L possibly damaging Het
Pmfbp1 A G 8: 109,520,300 D268G probably damaging Het
Rcbtb2 C A 14: 73,174,496 H408Q probably damaging Het
Sptbn1 A T 11: 30,146,803 V271E probably damaging Het
Sptlc3 T A 2: 139,566,685 V240E probably benign Het
Stat4 A G 1: 52,106,914 N742S probably benign Het
Tas2r118 T A 6: 23,969,618 Y148F probably benign Het
Trmt5 G T 12: 73,284,794 Q163K probably benign Het
Ube2d1 T A 10: 71,262,095 I37F probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vps13b C T 15: 35,841,333 P2503L probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68343838 critical splice donor site probably null
R9053:Erbb4 UTSW 1 68250620 missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68349393 missense probably damaging 1.00
R9350:Erbb4 UTSW 1 68290479 missense probably benign 0.00
R9374:Erbb4 UTSW 1 68740483 nonsense probably null
R9434:Erbb4 UTSW 1 68042614 missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68740483 nonsense probably null
R9551:Erbb4 UTSW 1 68740483 nonsense probably null
R9753:Erbb4 UTSW 1 68198903 missense probably benign 0.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AACCCAATTTCTTGTTCAGGTG -3'
(R):5'- ACTCCTGCTGTAATGGTACCC -3'

Sequencing Primer
(F):5'- ACTTAGGCACATAGATGCCGTTG -3'
(R):5'- CTGCTGTAATGGTACCCTACGAAAG -3'
Posted On 2022-02-07