Incidental Mutation 'R9237:Myom2'
ID 700535
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 15107653-15183410 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15152591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 646 (V646A)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000033842
AA Change: V646A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: V646A

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,318,557 (GRCm39) N1815K probably damaging Het
Acat1 C A 9: 53,494,816 (GRCm39) A359S probably damaging Het
Actn1 T C 12: 80,240,470 (GRCm39) N206D possibly damaging Het
Adgrf4 T A 17: 42,980,782 (GRCm39) H101L probably benign Het
Ager T A 17: 34,816,869 (GRCm39) M1K probably null Het
Akap12 T C 10: 4,307,231 (GRCm39) I1452T probably benign Het
Arap3 G A 18: 38,112,934 (GRCm39) A1092V possibly damaging Het
Bnip5 T C 17: 29,123,522 (GRCm39) E392G probably benign Het
C8b A G 4: 104,650,481 (GRCm39) T430A probably benign Het
Dars2 G A 1: 160,873,025 (GRCm39) R455W probably damaging Het
Erbb4 T G 1: 68,081,601 (GRCm39) Q1144H possibly damaging Het
Exoc2 G A 13: 31,048,858 (GRCm39) H732Y probably benign Het
Fhad1 T A 4: 141,632,483 (GRCm39) M1219L probably benign Het
Fktn G A 4: 53,734,854 (GRCm39) G125D probably benign Het
Gna15 T C 10: 81,359,683 (GRCm39) K36E possibly damaging Het
Gpr156 C T 16: 37,825,648 (GRCm39) Q622* probably null Het
Grip1 C T 10: 119,911,310 (GRCm39) S1091L probably benign Het
H4c12 A G 13: 21,934,534 (GRCm39) S48P probably damaging Het
Helt A G 8: 46,745,536 (GRCm39) F154L probably benign Het
Ide T C 19: 37,307,898 (GRCm39) N38S Het
Ighg2b A T 12: 113,270,217 (GRCm39) V267E Het
Map3k10 C T 7: 27,357,842 (GRCm39) W645* probably null Het
Mcrip1 G A 11: 120,435,542 (GRCm39) P31L probably damaging Het
Mttp T C 3: 137,810,444 (GRCm39) E657G probably benign Het
Myom1 C T 17: 71,408,051 (GRCm39) T1195I probably damaging Het
Nlrc3 A T 16: 3,783,073 (GRCm39) M128K probably benign Het
Nr2f6 A C 8: 71,831,073 (GRCm39) C112W probably damaging Het
Or5af1 A T 11: 58,722,057 (GRCm39) I26F possibly damaging Het
Or5m13b T A 2: 85,754,267 (GRCm39) Y218* probably null Het
P2rx3 T C 2: 84,853,896 (GRCm39) N139S probably benign Het
Pcdha11 T A 18: 37,145,260 (GRCm39) N450K probably damaging Het
Phb1 T C 11: 95,566,034 (GRCm39) I106T possibly damaging Het
Phyhipl C A 10: 70,406,720 (GRCm39) R78L possibly damaging Het
Pmfbp1 A G 8: 110,246,932 (GRCm39) D268G probably damaging Het
Pramel39-ps G T 5: 94,451,001 (GRCm39) P375H probably damaging Het
Rcbtb2 C A 14: 73,411,936 (GRCm39) H408Q probably damaging Het
Sptbn1 A T 11: 30,096,803 (GRCm39) V271E probably damaging Het
Sptlc3 T A 2: 139,408,605 (GRCm39) V240E probably benign Het
Stat4 A G 1: 52,146,073 (GRCm39) N742S probably benign Het
Tas2r118 T A 6: 23,969,617 (GRCm39) Y148F probably benign Het
Trmt5 G T 12: 73,331,568 (GRCm39) Q163K probably benign Het
Ube2d1 T A 10: 71,097,925 (GRCm39) I37F probably damaging Het
Vmn1r43 G A 6: 89,846,877 (GRCm39) T203M probably damaging Het
Vps13b C T 15: 35,841,479 (GRCm39) P2503L probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15,119,490 (GRCm39) missense probably damaging 1.00
IGL00426:Myom2 APN 8 15,119,502 (GRCm39) missense probably benign 0.00
IGL00503:Myom2 APN 8 15,164,289 (GRCm39) splice site probably null
IGL01515:Myom2 APN 8 15,172,655 (GRCm39) missense probably benign 0.15
IGL01649:Myom2 APN 8 15,163,755 (GRCm39) missense probably benign 0.24
IGL01658:Myom2 APN 8 15,127,880 (GRCm39) missense probably damaging 1.00
IGL01786:Myom2 APN 8 15,156,330 (GRCm39) missense probably damaging 0.99
IGL01924:Myom2 APN 8 15,119,685 (GRCm39) missense probably benign 0.37
IGL01929:Myom2 APN 8 15,167,698 (GRCm39) missense probably damaging 0.96
IGL02016:Myom2 APN 8 15,175,195 (GRCm39) missense probably benign 0.01
IGL02511:Myom2 APN 8 15,115,743 (GRCm39) missense probably benign
IGL02558:Myom2 APN 8 15,164,237 (GRCm39) missense probably benign 0.31
IGL02944:Myom2 APN 8 15,154,065 (GRCm39) critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15,173,442 (GRCm39) splice site probably benign
IGL03195:Myom2 APN 8 15,161,844 (GRCm39) nonsense probably null
IGL03288:Myom2 APN 8 15,172,679 (GRCm39) missense probably damaging 0.99
IGL03402:Myom2 APN 8 15,115,731 (GRCm39) missense probably benign
yomama UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
yoyoma UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R0069:Myom2 UTSW 8 15,167,624 (GRCm39) missense probably benign
R0116:Myom2 UTSW 8 15,167,633 (GRCm39) missense probably damaging 1.00
R0131:Myom2 UTSW 8 15,133,329 (GRCm39) missense probably damaging 0.98
R0373:Myom2 UTSW 8 15,148,419 (GRCm39) missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15,154,123 (GRCm39) missense probably benign 0.09
R0544:Myom2 UTSW 8 15,119,796 (GRCm39) missense probably damaging 1.00
R0629:Myom2 UTSW 8 15,119,783 (GRCm39) missense probably damaging 0.98
R0634:Myom2 UTSW 8 15,169,216 (GRCm39) splice site probably benign
R0645:Myom2 UTSW 8 15,167,698 (GRCm39) missense probably damaging 0.96
R0730:Myom2 UTSW 8 15,149,326 (GRCm39) missense probably benign 0.00
R0744:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R0836:Myom2 UTSW 8 15,182,924 (GRCm39) nonsense probably null
R1033:Myom2 UTSW 8 15,158,934 (GRCm39) missense probably benign 0.04
R1103:Myom2 UTSW 8 15,160,827 (GRCm39) missense probably benign 0.22
R1110:Myom2 UTSW 8 15,172,413 (GRCm39) missense probably benign 0.44
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1208:Myom2 UTSW 8 15,134,631 (GRCm39) missense probably damaging 1.00
R1353:Myom2 UTSW 8 15,156,424 (GRCm39) missense probably damaging 1.00
R1530:Myom2 UTSW 8 15,172,384 (GRCm39) missense probably damaging 1.00
R1544:Myom2 UTSW 8 15,154,059 (GRCm39) splice site probably benign
R1576:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably damaging 1.00
R1758:Myom2 UTSW 8 15,115,795 (GRCm39) missense probably benign 0.00
R1884:Myom2 UTSW 8 15,164,278 (GRCm39) missense probably benign 0.01
R1908:Myom2 UTSW 8 15,131,023 (GRCm39) missense probably damaging 1.00
R1962:Myom2 UTSW 8 15,182,599 (GRCm39) splice site probably null
R1977:Myom2 UTSW 8 15,135,263 (GRCm39) missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15,181,151 (GRCm39) missense probably damaging 1.00
R2049:Myom2 UTSW 8 15,156,379 (GRCm39) missense probably damaging 0.97
R2155:Myom2 UTSW 8 15,134,555 (GRCm39) missense probably damaging 0.98
R2314:Myom2 UTSW 8 15,113,927 (GRCm39) missense probably damaging 0.99
R2350:Myom2 UTSW 8 15,158,835 (GRCm39) missense probably benign 0.09
R2358:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15,148,348 (GRCm39) missense probably benign 0.00
R3418:Myom2 UTSW 8 15,135,294 (GRCm39) missense probably benign 0.01
R3606:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3607:Myom2 UTSW 8 15,119,775 (GRCm39) missense probably damaging 1.00
R3735:Myom2 UTSW 8 15,119,676 (GRCm39) missense probably benign 0.01
R3756:Myom2 UTSW 8 15,152,650 (GRCm39) missense probably benign 0.11
R3902:Myom2 UTSW 8 15,154,165 (GRCm39) missense probably benign
R3951:Myom2 UTSW 8 15,134,556 (GRCm39) missense probably benign 0.35
R4240:Myom2 UTSW 8 15,182,895 (GRCm39) missense probably benign 0.10
R4361:Myom2 UTSW 8 15,162,018 (GRCm39) missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15,156,459 (GRCm39) missense probably benign 0.02
R4736:Myom2 UTSW 8 15,131,271 (GRCm39) missense probably damaging 0.99
R5010:Myom2 UTSW 8 15,133,310 (GRCm39) missense probably damaging 0.98
R5108:Myom2 UTSW 8 15,182,667 (GRCm39) missense probably damaging 0.99
R5370:Myom2 UTSW 8 15,149,343 (GRCm39) missense probably benign 0.10
R5427:Myom2 UTSW 8 15,163,764 (GRCm39) missense probably benign 0.03
R5498:Myom2 UTSW 8 15,179,142 (GRCm39) missense probably benign 0.01
R5504:Myom2 UTSW 8 15,178,879 (GRCm39) missense probably damaging 1.00
R5567:Myom2 UTSW 8 15,152,546 (GRCm39) missense probably benign 0.01
R5743:Myom2 UTSW 8 15,130,914 (GRCm39) missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15,172,705 (GRCm39) missense probably benign 0.01
R5844:Myom2 UTSW 8 15,181,182 (GRCm39) critical splice donor site probably null
R5854:Myom2 UTSW 8 15,158,478 (GRCm39) missense probably benign
R6141:Myom2 UTSW 8 15,113,903 (GRCm39) missense probably damaging 1.00
R6209:Myom2 UTSW 8 15,154,173 (GRCm39) missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15,148,472 (GRCm39) splice site probably null
R6378:Myom2 UTSW 8 15,149,356 (GRCm39) missense probably benign 0.11
R6829:Myom2 UTSW 8 15,172,643 (GRCm39) nonsense probably null
R6913:Myom2 UTSW 8 15,115,710 (GRCm39) missense probably benign
R6957:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6958:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6960:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6961:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6962:Myom2 UTSW 8 15,167,741 (GRCm39) missense probably null 0.42
R6999:Myom2 UTSW 8 15,134,531 (GRCm39) missense probably benign 0.22
R7148:Myom2 UTSW 8 15,134,577 (GRCm39) missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15,154,114 (GRCm39) missense probably damaging 1.00
R7298:Myom2 UTSW 8 15,148,411 (GRCm39) missense probably damaging 1.00
R7463:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably null 0.94
R7535:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7573:Myom2 UTSW 8 15,172,450 (GRCm39) missense probably damaging 1.00
R7590:Myom2 UTSW 8 15,167,679 (GRCm39) missense probably damaging 1.00
R7690:Myom2 UTSW 8 15,161,717 (GRCm39) critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15,133,259 (GRCm39) missense probably damaging 1.00
R7822:Myom2 UTSW 8 15,158,454 (GRCm39) missense probably benign
R7948:Myom2 UTSW 8 15,135,306 (GRCm39) missense probably benign 0.00
R8094:Myom2 UTSW 8 15,119,418 (GRCm39) missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15,179,157 (GRCm39) missense probably damaging 1.00
R8292:Myom2 UTSW 8 15,182,888 (GRCm39) missense probably benign 0.01
R8514:Myom2 UTSW 8 15,175,153 (GRCm39) missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15,164,254 (GRCm39) missense probably benign 0.01
R8790:Myom2 UTSW 8 15,169,242 (GRCm39) missense probably damaging 1.00
R8824:Myom2 UTSW 8 15,164,169 (GRCm39) missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15,152,589 (GRCm39) nonsense probably null
R9024:Myom2 UTSW 8 15,113,936 (GRCm39) missense probably damaging 1.00
R9129:Myom2 UTSW 8 15,154,068 (GRCm39) missense probably damaging 1.00
R9224:Myom2 UTSW 8 15,178,804 (GRCm39) missense possibly damaging 0.89
R9321:Myom2 UTSW 8 15,172,464 (GRCm39) missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9343:Myom2 UTSW 8 15,134,633 (GRCm39) missense probably damaging 0.97
R9375:Myom2 UTSW 8 15,149,210 (GRCm39) missense probably damaging 1.00
R9455:Myom2 UTSW 8 15,156,293 (GRCm39) missense probably benign 0.31
R9563:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
R9565:Myom2 UTSW 8 15,158,399 (GRCm39) nonsense probably null
RF001:Myom2 UTSW 8 15,131,418 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGAAGCCCCATCTAGAGCTCAC -3'
(R):5'- ATGGGCATTCTACTGTGGTC -3'

Sequencing Primer
(F):5'- ATTGAACCTGGTGTATACTCCTTG -3'
(R):5'- GCATTCTACTGTGGTCTCTCGAG -3'
Posted On 2022-02-07