Incidental Mutation 'R9237:Myom2'
ID 700535
Institutional Source Beutler Lab
Gene Symbol Myom2
Ensembl Gene ENSMUSG00000031461
Gene Name myomesin 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 15057653-15133541 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15102591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 646 (V646A)
Ref Sequence ENSEMBL: ENSMUSP00000033842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033842]
AlphaFold Q14BI5
Predicted Effect possibly damaging
Transcript: ENSMUST00000033842
AA Change: V646A

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033842
Gene: ENSMUSG00000031461
AA Change: V646A

DomainStartEndE-ValueType
low complexity region 34 63 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
coiled coil region 97 129 N/A INTRINSIC
IG 160 247 7.7e-5 SMART
IG 284 373 8.01e-3 SMART
FN3 383 466 1.5e-14 SMART
FN3 511 594 1.79e-12 SMART
FN3 612 693 1.95e-13 SMART
FN3 711 794 8.69e-11 SMART
FN3 813 896 1.86e-10 SMART
IG_like 913 999 1.58e2 SMART
Blast:IG_like 1021 1106 1e-44 BLAST
IG_like 1135 1215 2.27e1 SMART
Blast:IG_like 1227 1321 9e-51 BLAST
IGc2 1357 1425 4.96e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD and 165 kD. The predicted MYOM2 protein contains 1,465 amino acids. Like MYOM1, MYOM2 has a unique N-terminal domain followed by 12 repeat domains with strong homology to either fibronectin type III or immunoglobulin C2 domains. Protein sequence comparisons suggested that the MYOM2 protein and bovine M protein are identical. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,904,548 E392G probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A T 1: 71,279,398 N1815K probably damaging Het
Acat1 C A 9: 53,583,516 A359S probably damaging Het
Actn1 T C 12: 80,193,696 N206D possibly damaging Het
Adgrf4 T A 17: 42,669,891 H101L probably benign Het
Ager T A 17: 34,597,895 M1K probably null Het
Akap12 T C 10: 4,357,231 I1452T probably benign Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
C8b A G 4: 104,793,284 T430A probably benign Het
Dars2 G A 1: 161,045,455 R455W probably damaging Het
Erbb4 T G 1: 68,042,442 Q1144H possibly damaging Het
Exoc2 G A 13: 30,864,875 H732Y probably benign Het
Fhad1 T A 4: 141,905,172 M1219L probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gna15 T C 10: 81,523,849 K36E possibly damaging Het
Gpr156 C T 16: 38,005,286 Q622* probably null Het
Grip1 C T 10: 120,075,405 S1091L probably benign Het
Helt A G 8: 46,292,499 F154L probably benign Het
Hist1h4k A G 13: 21,750,364 S48P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Ighg2b A T 12: 113,306,597 V267E Het
Map3k10 C T 7: 27,658,417 W645* probably null Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Mttp T C 3: 138,104,683 E657G probably benign Het
Myom1 C T 17: 71,101,056 T1195I probably damaging Het
Nlrc3 A T 16: 3,965,209 M128K probably benign Het
Nr2f6 A C 8: 71,378,429 C112W probably damaging Het
Olfr1026 T A 2: 85,923,923 Y218* probably null Het
Olfr312 A T 11: 58,831,231 I26F possibly damaging Het
P2rx3 T C 2: 85,023,552 N139S probably benign Het
Pcdha11 T A 18: 37,012,207 N450K probably damaging Het
Phb T C 11: 95,675,208 I106T possibly damaging Het
Phyhipl C A 10: 70,570,890 R78L possibly damaging Het
Pmfbp1 A G 8: 109,520,300 D268G probably damaging Het
Rcbtb2 C A 14: 73,174,496 H408Q probably damaging Het
Sptbn1 A T 11: 30,146,803 V271E probably damaging Het
Sptlc3 T A 2: 139,566,685 V240E probably benign Het
Stat4 A G 1: 52,106,914 N742S probably benign Het
Tas2r118 T A 6: 23,969,618 Y148F probably benign Het
Trmt5 G T 12: 73,284,794 Q163K probably benign Het
Ube2d1 T A 10: 71,262,095 I37F probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vps13b C T 15: 35,841,333 P2503L probably damaging Het
Other mutations in Myom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom2 APN 8 15069490 missense probably damaging 1.00
IGL00426:Myom2 APN 8 15069502 missense probably benign 0.00
IGL00503:Myom2 APN 8 15114289 splice site probably null
IGL01515:Myom2 APN 8 15122655 missense probably benign 0.15
IGL01649:Myom2 APN 8 15113755 missense probably benign 0.24
IGL01658:Myom2 APN 8 15077880 missense probably damaging 1.00
IGL01786:Myom2 APN 8 15106330 missense probably damaging 0.99
IGL01924:Myom2 APN 8 15069685 missense probably benign 0.37
IGL01929:Myom2 APN 8 15117698 missense probably damaging 0.96
IGL02016:Myom2 APN 8 15125195 missense probably benign 0.01
IGL02511:Myom2 APN 8 15065743 missense probably benign
IGL02558:Myom2 APN 8 15114237 missense probably benign 0.31
IGL02944:Myom2 APN 8 15104065 critical splice acceptor site probably null
IGL03052:Myom2 APN 8 15123442 splice site probably benign
IGL03195:Myom2 APN 8 15111844 nonsense probably null
IGL03288:Myom2 APN 8 15122679 missense probably damaging 0.99
IGL03402:Myom2 APN 8 15065731 missense probably benign
yomama UTSW 8 15132895 missense probably benign 0.10
yoyoma UTSW 8 15132667 missense probably damaging 0.99
R0069:Myom2 UTSW 8 15117624 missense probably benign
R0116:Myom2 UTSW 8 15117633 missense probably damaging 1.00
R0131:Myom2 UTSW 8 15083329 missense probably damaging 0.98
R0373:Myom2 UTSW 8 15098419 missense possibly damaging 0.91
R0463:Myom2 UTSW 8 15104123 missense probably benign 0.09
R0544:Myom2 UTSW 8 15069796 missense probably damaging 1.00
R0629:Myom2 UTSW 8 15069783 missense probably damaging 0.98
R0634:Myom2 UTSW 8 15119216 splice site probably benign
R0645:Myom2 UTSW 8 15117698 missense probably damaging 0.96
R0730:Myom2 UTSW 8 15099326 missense probably benign 0.00
R0744:Myom2 UTSW 8 15132924 nonsense probably null
R0836:Myom2 UTSW 8 15132924 nonsense probably null
R1033:Myom2 UTSW 8 15108934 missense probably benign 0.04
R1103:Myom2 UTSW 8 15110827 missense probably benign 0.22
R1110:Myom2 UTSW 8 15122413 missense probably benign 0.44
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1208:Myom2 UTSW 8 15084631 missense probably damaging 1.00
R1353:Myom2 UTSW 8 15106424 missense probably damaging 1.00
R1530:Myom2 UTSW 8 15122384 missense probably damaging 1.00
R1544:Myom2 UTSW 8 15104059 splice site probably benign
R1576:Myom2 UTSW 8 15084556 missense probably damaging 1.00
R1758:Myom2 UTSW 8 15065795 missense probably benign 0.00
R1884:Myom2 UTSW 8 15114278 missense probably benign 0.01
R1908:Myom2 UTSW 8 15081023 missense probably damaging 1.00
R1962:Myom2 UTSW 8 15132599 splice site probably null
R1977:Myom2 UTSW 8 15085263 missense possibly damaging 0.47
R2018:Myom2 UTSW 8 15131151 missense probably damaging 1.00
R2049:Myom2 UTSW 8 15106379 missense probably damaging 0.97
R2155:Myom2 UTSW 8 15084555 missense probably damaging 0.98
R2314:Myom2 UTSW 8 15063927 missense probably damaging 0.99
R2350:Myom2 UTSW 8 15108835 missense probably benign 0.09
R2358:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R2904:Myom2 UTSW 8 15098348 missense probably benign 0.00
R3418:Myom2 UTSW 8 15085294 missense probably benign 0.01
R3606:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3607:Myom2 UTSW 8 15069775 missense probably damaging 1.00
R3735:Myom2 UTSW 8 15069676 missense probably benign 0.01
R3756:Myom2 UTSW 8 15102650 missense probably benign 0.11
R3902:Myom2 UTSW 8 15104165 missense probably benign
R3951:Myom2 UTSW 8 15084556 missense probably benign 0.35
R4240:Myom2 UTSW 8 15132895 missense probably benign 0.10
R4361:Myom2 UTSW 8 15112018 missense possibly damaging 0.68
R4581:Myom2 UTSW 8 15106459 missense probably benign 0.02
R4736:Myom2 UTSW 8 15081271 missense probably damaging 0.99
R5010:Myom2 UTSW 8 15083310 missense probably damaging 0.98
R5108:Myom2 UTSW 8 15132667 missense probably damaging 0.99
R5370:Myom2 UTSW 8 15099343 missense probably benign 0.10
R5427:Myom2 UTSW 8 15113764 missense probably benign 0.03
R5498:Myom2 UTSW 8 15129142 missense probably benign 0.01
R5504:Myom2 UTSW 8 15128879 missense probably damaging 1.00
R5567:Myom2 UTSW 8 15102546 missense probably benign 0.01
R5743:Myom2 UTSW 8 15080914 missense possibly damaging 0.82
R5745:Myom2 UTSW 8 15122705 missense probably benign 0.01
R5844:Myom2 UTSW 8 15131182 critical splice donor site probably null
R5854:Myom2 UTSW 8 15108478 missense probably benign
R6141:Myom2 UTSW 8 15063903 missense probably damaging 1.00
R6209:Myom2 UTSW 8 15104173 missense possibly damaging 0.76
R6248:Myom2 UTSW 8 15098472 splice site probably null
R6378:Myom2 UTSW 8 15099356 missense probably benign 0.11
R6829:Myom2 UTSW 8 15122643 nonsense probably null
R6913:Myom2 UTSW 8 15065710 missense probably benign
R6957:Myom2 UTSW 8 15117741 missense probably null 0.42
R6958:Myom2 UTSW 8 15117741 missense probably null 0.42
R6960:Myom2 UTSW 8 15117741 missense probably null 0.42
R6961:Myom2 UTSW 8 15117741 missense probably null 0.42
R6962:Myom2 UTSW 8 15117741 missense probably null 0.42
R6999:Myom2 UTSW 8 15084531 missense probably benign 0.22
R7148:Myom2 UTSW 8 15084577 missense possibly damaging 0.72
R7210:Myom2 UTSW 8 15104114 missense probably damaging 1.00
R7298:Myom2 UTSW 8 15098411 missense probably damaging 1.00
R7463:Myom2 UTSW 8 15117679 missense probably null 0.94
R7535:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7573:Myom2 UTSW 8 15122450 missense probably damaging 1.00
R7590:Myom2 UTSW 8 15117679 missense probably damaging 1.00
R7690:Myom2 UTSW 8 15111717 critical splice acceptor site probably null
R7794:Myom2 UTSW 8 15083259 missense probably damaging 1.00
R7822:Myom2 UTSW 8 15108454 missense probably benign
R7948:Myom2 UTSW 8 15085306 missense probably benign 0.00
R8094:Myom2 UTSW 8 15069418 missense possibly damaging 0.94
R8268:Myom2 UTSW 8 15129157 missense probably damaging 1.00
R8292:Myom2 UTSW 8 15132888 missense probably benign 0.01
R8514:Myom2 UTSW 8 15125153 missense possibly damaging 0.65
R8539:Myom2 UTSW 8 15114254 missense probably benign 0.01
R8790:Myom2 UTSW 8 15119242 missense probably damaging 1.00
R8824:Myom2 UTSW 8 15114169 missense possibly damaging 0.82
R8895:Myom2 UTSW 8 15102589 nonsense probably null
R9024:Myom2 UTSW 8 15063936 missense probably damaging 1.00
R9129:Myom2 UTSW 8 15104068 missense probably damaging 1.00
R9224:Myom2 UTSW 8 15128804 missense possibly damaging 0.89
R9321:Myom2 UTSW 8 15122464 missense possibly damaging 0.91
R9341:Myom2 UTSW 8 15084633 missense probably damaging 0.97
R9343:Myom2 UTSW 8 15084633 missense probably damaging 0.97
R9375:Myom2 UTSW 8 15099210 missense probably damaging 1.00
R9455:Myom2 UTSW 8 15106293 missense probably benign 0.31
R9563:Myom2 UTSW 8 15108399 nonsense probably null
R9565:Myom2 UTSW 8 15108399 nonsense probably null
RF001:Myom2 UTSW 8 15081418 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGAAGCCCCATCTAGAGCTCAC -3'
(R):5'- ATGGGCATTCTACTGTGGTC -3'

Sequencing Primer
(F):5'- ATTGAACCTGGTGTATACTCCTTG -3'
(R):5'- GCATTCTACTGTGGTCTCTCGAG -3'
Posted On 2022-02-07