Incidental Mutation 'R9237:Mcrip1'
ID 700548
Institutional Source Beutler Lab
Gene Symbol Mcrip1
Ensembl Gene ENSMUSG00000061111
Gene Name MAPK regulated corepressor interacting protein 1
Synonyms BC003940, Fam195b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 120542888-120549727 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120544716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 31 (P31L)
Ref Sequence ENSEMBL: ENSMUSP00000034913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034913]
AlphaFold Q3UGS4
Predicted Effect probably damaging
Transcript: ENSMUST00000034913
AA Change: P31L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034913
Gene: ENSMUSG00000061111
AA Change: P31L

DomainStartEndE-ValueType
Pfam:FAM195 4 94 3.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,904,548 E392G probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A T 1: 71,279,398 N1815K probably damaging Het
Acat1 C A 9: 53,583,516 A359S probably damaging Het
Actn1 T C 12: 80,193,696 N206D possibly damaging Het
Adgrf4 T A 17: 42,669,891 H101L probably benign Het
Ager T A 17: 34,597,895 M1K probably null Het
Akap12 T C 10: 4,357,231 I1452T probably benign Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
C8b A G 4: 104,793,284 T430A probably benign Het
Dars2 G A 1: 161,045,455 R455W probably damaging Het
Erbb4 T G 1: 68,042,442 Q1144H possibly damaging Het
Exoc2 G A 13: 30,864,875 H732Y probably benign Het
Fhad1 T A 4: 141,905,172 M1219L probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gna15 T C 10: 81,523,849 K36E possibly damaging Het
Gpr156 C T 16: 38,005,286 Q622* probably null Het
Grip1 C T 10: 120,075,405 S1091L probably benign Het
Helt A G 8: 46,292,499 F154L probably benign Het
Hist1h4k A G 13: 21,750,364 S48P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Ighg2b A T 12: 113,306,597 V267E Het
Map3k10 C T 7: 27,658,417 W645* probably null Het
Mttp T C 3: 138,104,683 E657G probably benign Het
Myom1 C T 17: 71,101,056 T1195I probably damaging Het
Myom2 T C 8: 15,102,591 V646A possibly damaging Het
Nlrc3 A T 16: 3,965,209 M128K probably benign Het
Nr2f6 A C 8: 71,378,429 C112W probably damaging Het
Olfr1026 T A 2: 85,923,923 Y218* probably null Het
Olfr312 A T 11: 58,831,231 I26F possibly damaging Het
P2rx3 T C 2: 85,023,552 N139S probably benign Het
Pcdha11 T A 18: 37,012,207 N450K probably damaging Het
Phb T C 11: 95,675,208 I106T possibly damaging Het
Phyhipl C A 10: 70,570,890 R78L possibly damaging Het
Pmfbp1 A G 8: 109,520,300 D268G probably damaging Het
Rcbtb2 C A 14: 73,174,496 H408Q probably damaging Het
Sptbn1 A T 11: 30,146,803 V271E probably damaging Het
Sptlc3 T A 2: 139,566,685 V240E probably benign Het
Stat4 A G 1: 52,106,914 N742S probably benign Het
Tas2r118 T A 6: 23,969,618 Y148F probably benign Het
Trmt5 G T 12: 73,284,794 Q163K probably benign Het
Ube2d1 T A 10: 71,262,095 I37F probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vps13b C T 15: 35,841,333 P2503L probably damaging Het
Other mutations in Mcrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
devonian UTSW 11 120544679 critical splice donor site probably null
R0184:Mcrip1 UTSW 11 120544884 start codon destroyed probably null 0.00
R2289:Mcrip1 UTSW 11 120544704 missense probably damaging 1.00
R2304:Mcrip1 UTSW 11 120544693 missense probably damaging 1.00
R7185:Mcrip1 UTSW 11 120544679 critical splice donor site probably null
R8811:Mcrip1 UTSW 11 120544779 missense probably damaging 1.00
R9142:Mcrip1 UTSW 11 120544716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGACCATCTCCCAGATCCTG -3'
(R):5'- TGGACATCCCAGCAATGACC -3'

Sequencing Primer
(F):5'- TGCGTTGTCACCCCAATG -3'
(R):5'- TCCCAGCAATGACCAGGTG -3'
Posted On 2022-02-07