Incidental Mutation 'R9237:Trmt5'
ID 700549
Institutional Source Beutler Lab
Gene Symbol Trmt5
Ensembl Gene ENSMUSG00000034442
Gene Name TRM5 tRNA methyltransferase 5
Synonyms 2610027O18Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 73280011-73286710 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 73284794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 163 (Q163K)
Ref Sequence ENSEMBL: ENSMUSP00000112121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058139] [ENSMUST00000101313] [ENSMUST00000116420] [ENSMUST00000122920] [ENSMUST00000126488] [ENSMUST00000140523] [ENSMUST00000153941] [ENSMUST00000220701] [ENSMUST00000221189]
AlphaFold Q9D0C4
Predicted Effect probably benign
Transcript: ENSMUST00000058139
SMART Domains Protein: ENSMUSP00000057153
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101313
SMART Domains Protein: ENSMUSP00000098871
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 1 69 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116420
AA Change: Q163K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112121
Gene: ENSMUSG00000034442
AA Change: Q163K

DomainStartEndE-ValueType
Pfam:Met_10 191 412 4.5e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122920
SMART Domains Protein: ENSMUSP00000124386
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 113 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126488
SMART Domains Protein: ENSMUSP00000118374
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140523
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153941
SMART Domains Protein: ENSMUSP00000114870
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 124 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220701
Predicted Effect probably benign
Transcript: ENSMUST00000221189
AA Change: Q111K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 [PubMed 15248782]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,904,548 E392G probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A T 1: 71,279,398 N1815K probably damaging Het
Acat1 C A 9: 53,583,516 A359S probably damaging Het
Actn1 T C 12: 80,193,696 N206D possibly damaging Het
Adgrf4 T A 17: 42,669,891 H101L probably benign Het
Ager T A 17: 34,597,895 M1K probably null Het
Akap12 T C 10: 4,357,231 I1452T probably benign Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
C8b A G 4: 104,793,284 T430A probably benign Het
Dars2 G A 1: 161,045,455 R455W probably damaging Het
Erbb4 T G 1: 68,042,442 Q1144H possibly damaging Het
Exoc2 G A 13: 30,864,875 H732Y probably benign Het
Fhad1 T A 4: 141,905,172 M1219L probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gna15 T C 10: 81,523,849 K36E possibly damaging Het
Gpr156 C T 16: 38,005,286 Q622* probably null Het
Grip1 C T 10: 120,075,405 S1091L probably benign Het
Helt A G 8: 46,292,499 F154L probably benign Het
Hist1h4k A G 13: 21,750,364 S48P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Ighg2b A T 12: 113,306,597 V267E Het
Map3k10 C T 7: 27,658,417 W645* probably null Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Mttp T C 3: 138,104,683 E657G probably benign Het
Myom1 C T 17: 71,101,056 T1195I probably damaging Het
Myom2 T C 8: 15,102,591 V646A possibly damaging Het
Nlrc3 A T 16: 3,965,209 M128K probably benign Het
Nr2f6 A C 8: 71,378,429 C112W probably damaging Het
Olfr1026 T A 2: 85,923,923 Y218* probably null Het
Olfr312 A T 11: 58,831,231 I26F possibly damaging Het
P2rx3 T C 2: 85,023,552 N139S probably benign Het
Pcdha11 T A 18: 37,012,207 N450K probably damaging Het
Phb T C 11: 95,675,208 I106T possibly damaging Het
Phyhipl C A 10: 70,570,890 R78L possibly damaging Het
Pmfbp1 A G 8: 109,520,300 D268G probably damaging Het
Rcbtb2 C A 14: 73,174,496 H408Q probably damaging Het
Sptbn1 A T 11: 30,146,803 V271E probably damaging Het
Sptlc3 T A 2: 139,566,685 V240E probably benign Het
Stat4 A G 1: 52,106,914 N742S probably benign Het
Tas2r118 T A 6: 23,969,618 Y148F probably benign Het
Ube2d1 T A 10: 71,262,095 I37F probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vps13b C T 15: 35,841,333 P2503L probably damaging Het
Other mutations in Trmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Trmt5 APN 12 73284919 missense possibly damaging 0.80
IGL01468:Trmt5 APN 12 73281104 missense probably benign 0.08
IGL01681:Trmt5 APN 12 73282603 unclassified probably benign
IGL02502:Trmt5 APN 12 73281227 missense probably benign 0.06
IGL02627:Trmt5 APN 12 73281455 missense probably damaging 1.00
IGL02688:Trmt5 APN 12 73281458 nonsense probably null
IGL03390:Trmt5 APN 12 73282727 missense probably benign 0.30
IGL03391:Trmt5 APN 12 73281452 missense probably benign 0.00
R2068:Trmt5 UTSW 12 73284670 splice site probably null
R2239:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R2380:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R5169:Trmt5 UTSW 12 73282721 missense probably damaging 1.00
R5578:Trmt5 UTSW 12 73285063 splice site probably null
R5579:Trmt5 UTSW 12 73281652 missense possibly damaging 0.92
R7390:Trmt5 UTSW 12 73281620 missense probably damaging 1.00
R7991:Trmt5 UTSW 12 73282665 missense probably damaging 1.00
R9001:Trmt5 UTSW 12 73284869 missense probably benign 0.00
R9065:Trmt5 UTSW 12 73281264 missense probably damaging 1.00
R9277:Trmt5 UTSW 12 73282674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCTGACTGTAATCCACCTACC -3'
(R):5'- TGTCCATCCCTGTGCTTAAAGC -3'

Sequencing Primer
(F):5'- CCTACCAATTAAATGCTTGAAGGGC -3'
(R):5'- GTCAACAGATTGATGCGAGCCC -3'
Posted On 2022-02-07