Incidental Mutation 'R9237:Exoc2'
ID 700553
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R9237 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30864875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 732 (H732Y)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021785
AA Change: H732Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: H732Y

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102946
AA Change: H732Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: H732Y

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,904,548 E392G probably benign Het
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Abca12 A T 1: 71,279,398 N1815K probably damaging Het
Acat1 C A 9: 53,583,516 A359S probably damaging Het
Actn1 T C 12: 80,193,696 N206D possibly damaging Het
Adgrf4 T A 17: 42,669,891 H101L probably benign Het
Ager T A 17: 34,597,895 M1K probably null Het
Akap12 T C 10: 4,357,231 I1452T probably benign Het
Arap3 G A 18: 37,979,881 A1092V possibly damaging Het
C8b A G 4: 104,793,284 T430A probably benign Het
Dars2 G A 1: 161,045,455 R455W probably damaging Het
Erbb4 T G 1: 68,042,442 Q1144H possibly damaging Het
Fhad1 T A 4: 141,905,172 M1219L probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Gna15 T C 10: 81,523,849 K36E possibly damaging Het
Gpr156 C T 16: 38,005,286 Q622* probably null Het
Grip1 C T 10: 120,075,405 S1091L probably benign Het
Helt A G 8: 46,292,499 F154L probably benign Het
Hist1h4k A G 13: 21,750,364 S48P probably damaging Het
Ide T C 19: 37,330,499 N38S Het
Ighg2b A T 12: 113,306,597 V267E Het
Map3k10 C T 7: 27,658,417 W645* probably null Het
Mcrip1 G A 11: 120,544,716 P31L probably damaging Het
Mttp T C 3: 138,104,683 E657G probably benign Het
Myom1 C T 17: 71,101,056 T1195I probably damaging Het
Myom2 T C 8: 15,102,591 V646A possibly damaging Het
Nlrc3 A T 16: 3,965,209 M128K probably benign Het
Nr2f6 A C 8: 71,378,429 C112W probably damaging Het
Olfr1026 T A 2: 85,923,923 Y218* probably null Het
Olfr312 A T 11: 58,831,231 I26F possibly damaging Het
P2rx3 T C 2: 85,023,552 N139S probably benign Het
Pcdha11 T A 18: 37,012,207 N450K probably damaging Het
Phb T C 11: 95,675,208 I106T possibly damaging Het
Phyhipl C A 10: 70,570,890 R78L possibly damaging Het
Pmfbp1 A G 8: 109,520,300 D268G probably damaging Het
Rcbtb2 C A 14: 73,174,496 H408Q probably damaging Het
Sptbn1 A T 11: 30,146,803 V271E probably damaging Het
Sptlc3 T A 2: 139,566,685 V240E probably benign Het
Stat4 A G 1: 52,106,914 N742S probably benign Het
Tas2r118 T A 6: 23,969,618 Y148F probably benign Het
Trmt5 G T 12: 73,284,794 Q163K probably benign Het
Ube2d1 T A 10: 71,262,095 I37F probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vps13b C T 15: 35,841,333 P2503L probably damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
R9731:Exoc2 UTSW 13 30877250 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATCATTCTCAGATGGGTAGGGTG -3'
(R):5'- TGTGTGTTAATTTTAGGACACAGCC -3'

Sequencing Primer
(F):5'- CATTCTCAGATGGGTAGGGTGAAGAG -3'
(R):5'- GCATAGGATATTGATGTTAAAGGGC -3'
Posted On 2022-02-07