Incidental Mutation 'R9238:Optn'
ID 700569
Institutional Source Beutler Lab
Gene Symbol Optn
Ensembl Gene ENSMUSG00000026672
Gene Name optineurin
Synonyms TFIIIA-INTP, 4930441O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R9238 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 5020642-5064051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5053140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 73 (S73P)
Ref Sequence ENSEMBL: ENSMUSP00000027986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027986] [ENSMUST00000114996]
AlphaFold Q8K3K8
Predicted Effect probably damaging
Transcript: ENSMUST00000027986
AA Change: S73P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027986
Gene: ENSMUSG00000026672
AA Change: S73P

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
PDB:2ZVO|D 424 512 2e-11 PDB
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000114996
AA Change: S73P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110648
Gene: ENSMUSG00000026672
AA Change: S73P

DomainStartEndE-ValueType
Pfam:NEMO 37 104 2e-27 PFAM
coiled coil region 243 278 N/A INTRINSIC
Pfam:CC2-LZ 407 510 3.2e-33 PFAM
PDB:2LO4|A 551 584 4e-15 PDB
Blast:ZnF_C2H2 560 580 2e-6 BLAST
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice hypomorphic allele exhibit background sensitive embryonic lethality with surviving mice exhibiting normal immune cell development, T and B cell activation and TNF- or LPS-mediated activation of cells of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430089I19Rik G T 5: 94,303,142 P375H probably damaging Het
Agfg2 C A 5: 137,655,360 V365F probably damaging Het
Atxn7 A T 14: 14,089,441 N319I probably damaging Het
AY074887 C T 9: 54,950,803 V13M unknown Het
Boc T C 16: 44,490,658 T738A Het
C2cd5 A G 6: 143,081,401 V126A possibly damaging Het
Cdk9 A T 2: 32,708,261 L261Q possibly damaging Het
Chil1 T C 1: 134,187,947 L231P probably damaging Het
Ckap5 T A 2: 91,568,682 C604S probably null Het
Dopey1 T C 9: 86,532,974 V1923A probably benign Het
Dopey2 T C 16: 93,749,130 S230P probably benign Het
Eps15l1 T C 8: 72,341,430 E892G probably damaging Het
Fasn T C 11: 120,815,045 T1133A probably benign Het
Fktn G A 4: 53,734,854 G125D probably benign Het
Fras1 A T 5: 96,684,361 I1518F possibly damaging Het
Gm5724 G T 6: 141,740,427 T229K probably damaging Het
Gm884 G T 11: 103,619,033 P703Q unknown Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Herc2 T A 7: 56,163,760 C2580S probably damaging Het
Ino80b T A 6: 83,125,333 probably benign Het
Kdm2b T C 5: 122,871,826 R1274G probably damaging Het
Lcn12 A G 2: 25,492,261 I144T possibly damaging Het
Mroh5 T C 15: 73,791,737 N158S probably benign Het
Mtpap G T 18: 4,396,439 G577V probably damaging Het
Ncoa1 A G 12: 4,275,177 V967A possibly damaging Het
Ndufa11 T C 17: 56,721,112 Y61H probably benign Het
Nr2c2 T A 6: 92,167,549 N602K probably damaging Het
Nubp1 C A 16: 10,413,740 T85K probably benign Het
Olfr1387 A G 11: 49,459,702 T8A probably benign Het
Olfr218 T C 1: 173,203,785 I143T probably benign Het
Oosp3 A G 19: 11,699,389 I37M probably damaging Het
Osmr T G 15: 6,816,605 I779L possibly damaging Het
Pcdh20 T C 14: 88,468,754 D370G probably benign Het
Pgap1 A G 1: 54,511,411 S571P probably benign Het
Pgbd5 A G 8: 124,380,191 I204T probably damaging Het
Pkhd1 A G 1: 20,534,575 I1172T possibly damaging Het
Plch1 T A 3: 63,698,991 H1164L possibly damaging Het
Rab38 T A 7: 88,450,746 F156L possibly damaging Het
Rtl1 T C 12: 109,594,583 E274G possibly damaging Het
Serpinb9 A G 13: 33,015,496 D258G probably benign Het
Slc26a11 T C 11: 119,374,907 probably null Het
Stard9 C A 2: 120,697,966 T1568N probably damaging Het
Ston2 T C 12: 91,648,687 T316A probably benign Het
Tacc1 A T 8: 25,182,618 M198K probably benign Het
Tspan33 T C 6: 29,710,653 F76S probably damaging Het
Tspyl5 T C 15: 33,686,936 I288V possibly damaging Het
Vmn2r50 G A 7: 10,047,576 S414F probably benign Het
Zfp141 G A 7: 42,475,687 R454* probably null Het
Zscan22 T A 7: 12,907,148 C440S probably damaging Het
Zscan4-ps2 A T 7: 11,517,412 Q153L probably damaging Het
Other mutations in Optn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Optn APN 2 5033156 missense possibly damaging 0.93
IGL01433:Optn APN 2 5027144 missense probably benign 0.07
IGL01480:Optn APN 2 5046018 missense probably benign 0.01
IGL01863:Optn APN 2 5021487 splice site probably benign
IGL02108:Optn APN 2 5031273 missense possibly damaging 0.91
IGL02150:Optn APN 2 5033152 missense probably damaging 0.97
IGL02623:Optn APN 2 5035022 missense probably damaging 1.00
R0119:Optn UTSW 2 5024115 missense probably damaging 1.00
R0121:Optn UTSW 2 5024115 missense probably damaging 1.00
R0330:Optn UTSW 2 5034255 missense possibly damaging 0.53
R0332:Optn UTSW 2 5024115 missense probably damaging 1.00
R0335:Optn UTSW 2 5024115 missense probably damaging 1.00
R0390:Optn UTSW 2 5046195 missense probably benign
R0437:Optn UTSW 2 5024115 missense probably damaging 1.00
R1710:Optn UTSW 2 5053130 missense possibly damaging 0.90
R2229:Optn UTSW 2 5024117 missense probably damaging 1.00
R3237:Optn UTSW 2 5034203 missense probably damaging 1.00
R3740:Optn UTSW 2 5034198 missense possibly damaging 0.51
R3741:Optn UTSW 2 5034198 missense possibly damaging 0.51
R4667:Optn UTSW 2 5033139 missense probably benign 0.20
R4783:Optn UTSW 2 5054627 missense probably benign
R4965:Optn UTSW 2 5021379 missense probably benign 0.14
R5121:Optn UTSW 2 5046106 missense probably benign 0.25
R6119:Optn UTSW 2 5021323 splice site probably null
R7024:Optn UTSW 2 5052837 splice site probably null
R7167:Optn UTSW 2 5042483 missense probably benign 0.00
R7685:Optn UTSW 2 5054650 missense probably benign 0.01
R8103:Optn UTSW 2 5040202 missense probably damaging 0.97
R8267:Optn UTSW 2 5054651 missense probably benign 0.00
R8844:Optn UTSW 2 5027112 critical splice donor site probably null
R9082:Optn UTSW 2 5054640 missense probably damaging 1.00
R9141:Optn UTSW 2 5054674 missense possibly damaging 0.93
R9260:Optn UTSW 2 5040265 missense probably benign
R9287:Optn UTSW 2 5031315 missense probably damaging 0.98
R9426:Optn UTSW 2 5054674 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CACAGTGGATCGTGTACTCAC -3'
(R):5'- AACTGCTCACACCACTATGG -3'

Sequencing Primer
(F):5'- AGTGGATCGTGTACTCACTTCCAATG -3'
(R):5'- ATTTGCTGACATACCCATCCCAGG -3'
Posted On 2022-02-07