Incidental Mutation 'R9239:Aldh1l2'
ID 700640
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9239 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 83487450-83534140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83506632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 438 (F438S)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably damaging
Transcript: ENSMUST00000020497
AA Change: F551S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: F551S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect probably damaging
Transcript: ENSMUST00000146640
AA Change: F438S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: F438S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.8729 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk T A 17: 71,949,869 N665I probably benign Het
Anxa4 T A 6: 86,757,830 T59S probably benign Het
B3gnt8 ACCCC ACCC 7: 25,628,251 probably null Het
Cabs1 G A 5: 87,979,526 R12Q probably benign Het
Cep152 A G 2: 125,583,910 V845A probably benign Het
Dsg1a T A 18: 20,340,693 V941E probably damaging Het
Fam69a T C 5: 107,911,706 E127G possibly damaging Het
Fam84a A G 12: 14,150,184 W181R probably damaging Het
Fbxo11 G T 17: 88,009,094 H284N Het
Fubp1 A G 3: 152,217,849 E98G probably damaging Het
Fyco1 A G 9: 123,797,572 I1358T probably damaging Het
Ginm1 T C 10: 7,774,061 N156S possibly damaging Het
Gm3739 T C 14: 7,299,352 Y101C probably damaging Het
Gm4778 T A 3: 94,266,564 V289E probably benign Het
Ide T C 19: 37,330,499 N38S Het
Itgb4 T C 11: 116,007,304 V1644A probably damaging Het
Itpka A G 2: 119,749,542 D254G probably damaging Het
Kat7 T A 11: 95,306,194 R6S probably benign Het
Klhl40 A T 9: 121,778,571 T266S probably benign Het
Mmaa T C 8: 79,269,227 D289G probably damaging Het
Muc5ac A T 7: 141,800,217 D851V probably damaging Het
Olfr1414 T C 1: 92,511,732 T99A probably benign Het
Olfr389 A G 11: 73,776,520 V269A probably benign Het
Olfr658 G T 7: 104,644,539 H278N probably damaging Het
Pcdh17 T G 14: 84,533,209 I1042M probably benign Het
Pipox A G 11: 77,883,939 I106T probably benign Het
Ppcs C T 4: 119,419,038 V290M possibly damaging Het
Rnasel T A 1: 153,754,351 N204K probably damaging Het
Runx1 A G 16: 92,606,047 Y336H probably damaging Het
Sell A G 1: 164,065,607 I131V possibly damaging Het
Serpina3f A G 12: 104,218,451 R285G possibly damaging Het
Slc25a2 A T 18: 37,638,116 M120K possibly damaging Het
Slc47a1 A T 11: 61,359,518 probably null Het
Slc4a11 C T 2: 130,691,744 A100T probably damaging Het
Spats2l A G 1: 57,832,098 probably benign Het
Taf1b T A 12: 24,556,016 L431H probably damaging Het
Tectb CT C 19: 55,192,662 probably null Het
Thsd7b G A 1: 130,159,716 probably null Het
Tmtc4 A G 14: 122,927,666 Y594H possibly damaging Het
Trim33 T C 3: 103,330,137 F599L probably benign Het
Vcl A G 14: 21,022,024 D819G probably damaging Het
Vmn1r43 G A 6: 89,869,895 T203M probably damaging Het
Vmn2r1 G T 3: 64,104,538 V607L probably damaging Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83501921 missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83506642 missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83508677 missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83506681 missense probably benign 0.41
R9335:Aldh1l2 UTSW 10 83506646 missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83495952 nonsense probably null
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGATCTCGAGTTGCTCCTCTC -3'
(R):5'- CCTATACAGGGCTGGCATAC -3'

Sequencing Primer
(F):5'- GAGTTGCTCCTCTCCCTGGG -3'
(R):5'- TGGCATACCCAGCTGCTCTG -3'
Posted On 2022-02-07