Mutagenetix > Incidental Mutation

Incidental Mutation 'R9239:Aldh1l2'

700640

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9239 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83506632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 438 (F438S)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably damaging
Transcript: ENSMUST00000020497
AA Change: F551S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: F551S

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125193

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143793

Predicted Effect

probably damaging
Transcript: ENSMUST00000146640
AA Change: F438S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: F438S

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Meta Mutation Damage Score

0.8729

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot8	A	G	2: 164,804,688		probably null	Het
Alk	T	A	17: 71,949,869	N665I	probably benign	Het
Anxa4	T	A	6: 86,757,830	T59S	probably benign	Het
B3gnt8	ACCCC	ACCC	7: 25,628,251		probably null	Het
Cabs1	G	A	5: 87,979,526	R12Q	probably benign	Het
Cep152	A	G	2: 125,583,910	V845A	probably benign	Het
Dsg1a	T	A	18: 20,340,693	V941E	probably damaging	Het
Fam69a	T	C	5: 107,911,706	E127G	possibly damaging	Het
Fam84a	A	G	12: 14,150,184	W181R	probably damaging	Het
Fbxo11	G	T	17: 88,009,094	H284N		Het
Fubp1	A	G	3: 152,217,849	E98G	probably damaging	Het
Fyco1	A	G	9: 123,797,572	I1358T	probably damaging	Het
Ginm1	T	C	10: 7,774,061	N156S	possibly damaging	Het
Gm3739	T	C	14: 7,299,352	Y101C	probably damaging	Het
Gm4778	T	A	3: 94,266,564	V289E	probably benign	Het
Ide	T	C	19: 37,330,499	N38S		Het
Itgb4	T	C	11: 116,007,304	V1644A	probably damaging	Het
Itpka	A	G	2: 119,749,542	D254G	probably damaging	Het
Kat7	T	A	11: 95,306,194	R6S	probably benign	Het
Klhl40	A	T	9: 121,778,571	T266S	probably benign	Het
Mmaa	T	C	8: 79,269,227	D289G	probably damaging	Het
Muc5ac	A	T	7: 141,800,217	D851V	probably damaging	Het
Olfr1414	T	C	1: 92,511,732	T99A	probably benign	Het
Olfr389	A	G	11: 73,776,520	V269A	probably benign	Het
Olfr658	G	T	7: 104,644,539	H278N	probably damaging	Het
Pcdh17	T	G	14: 84,533,209	I1042M	probably benign	Het
Pipox	A	G	11: 77,883,939	I106T	probably benign	Het
Ppcs	C	T	4: 119,419,038	V290M	possibly damaging	Het
Rnasel	T	A	1: 153,754,351	N204K	probably damaging	Het
Runx1	A	G	16: 92,606,047	Y336H	probably damaging	Het
Sell	A	G	1: 164,065,607	I131V	possibly damaging	Het
Serpina3f	A	G	12: 104,218,451	R285G	possibly damaging	Het
Slc25a2	A	T	18: 37,638,116	M120K	possibly damaging	Het
Slc47a1	A	T	11: 61,359,518		probably null	Het
Slc4a11	C	T	2: 130,691,744	A100T	probably damaging	Het
Spats2l	A	G	1: 57,832,098		probably benign	Het
Taf1b	T	A	12: 24,556,016	L431H	probably damaging	Het
Tectb	CT	C	19: 55,192,662		probably null	Het
Thsd7b	G	A	1: 130,159,716		probably null	Het
Tmtc4	A	G	14: 122,927,666	Y594H	possibly damaging	Het
Trim33	T	C	3: 103,330,137	F599L	probably benign	Het
Vcl	A	G	14: 21,022,024	D819G	probably damaging	Het
Vmn1r43	G	A	6: 89,869,895	T203M	probably damaging	Het
Vmn2r1	G	T	3: 64,104,538	V607L	probably damaging	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5491:Aldh1l2	UTSW	10	83522785	missense	probably benign	0.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGATCTCGAGTTGCTCCTCTC -3'
(R):5'- CCTATACAGGGCTGGCATAC -3'

Sequencing Primer
(F):5'- GAGTTGCTCCTCTCCCTGGG -3'
(R):5'- TGGCATACCCAGCTGCTCTG -3'

Posted On

2022-02-07